ID: 919054000

View in Genome Browser
Species Human (GRCh38)
Location 1:192546127-192546149
Sequence GAGCAGATGCAGGCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919053997_919054000 -10 Left 919053997 1:192546114-192546136 CCAAGGCAGGAAGGAGCAGATGC No data
Right 919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919054000 Original CRISPR GAGCAGATGCAGGCTGAGGA AGG Intergenic
No off target data available for this crispr