ID: 919060969

View in Genome Browser
Species Human (GRCh38)
Location 1:192632295-192632317
Sequence GGAGACTCCTTTGGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919060965_919060969 12 Left 919060965 1:192632260-192632282 CCACATATGCATTTGAAGCATGA No data
Right 919060969 1:192632295-192632317 GGAGACTCCTTTGGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919060969 Original CRISPR GGAGACTCCTTTGGTAAAGC AGG Intergenic
No off target data available for this crispr