ID: 919062041

View in Genome Browser
Species Human (GRCh38)
Location 1:192645624-192645646
Sequence GTCCCCTCCATTCTTCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919062041_919062046 -1 Left 919062041 1:192645624-192645646 CCGCCCAGAAGAATGGAGGGGAC 0: 1
1: 0
2: 2
3: 8
4: 150
Right 919062046 1:192645646-192645668 CACAAGGGAGAACTTGTATCAGG 0: 1
1: 0
2: 2
3: 4
4: 131
919062041_919062047 7 Left 919062041 1:192645624-192645646 CCGCCCAGAAGAATGGAGGGGAC 0: 1
1: 0
2: 2
3: 8
4: 150
Right 919062047 1:192645654-192645676 AGAACTTGTATCAGGAAAAAAGG 0: 1
1: 0
2: 4
3: 84
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919062041 Original CRISPR GTCCCCTCCATTCTTCTGGG CGG (reversed) Intronic
901397580 1:8992683-8992705 CTCCCCTGGATTCTTCTGGTAGG - Intergenic
901439998 1:9272100-9272122 GTCCCCTCCCTGCTTCTCTGTGG + Intergenic
904900256 1:33851536-33851558 GTCCTCTCCATTCATCAGGGAGG - Intronic
907632101 1:56092987-56093009 TTCCCCTACATTCTTCAGGCTGG + Intergenic
908744334 1:67360980-67361002 ATCCCCTCTATTCTTCTAGGTGG + Intronic
909622486 1:77683452-77683474 GTCCCCTCCTTTCTCCTCGTTGG + Intergenic
913058377 1:115182846-115182868 GTTCCCTCCACTCTTTTTGGAGG + Intergenic
913096934 1:115527201-115527223 GTCCCCTACCTTTTTCTGGATGG - Intergenic
916511272 1:165474164-165474186 GGCCCCTCCATACTGCTGGATGG - Intergenic
918040918 1:180913232-180913254 GTCCCCTCCATCCCTCGGAGAGG - Exonic
918092341 1:181308299-181308321 GTTCCCTGCCTTCTTGTGGGAGG + Intergenic
919062041 1:192645624-192645646 GTCCCCTCCATTCTTCTGGGCGG - Intronic
919076558 1:192820512-192820534 TTCCACTCCAGTCTTCTGGTGGG - Intergenic
920399240 1:205666921-205666943 CTCCCCACCCTTGTTCTGGGAGG + Intronic
921816463 1:219569437-219569459 GTTCCTTCCATTCTGCTGGCAGG - Intergenic
922160687 1:223077576-223077598 CTCCCTTCCATCCTTCTGTGCGG + Intergenic
922193541 1:223340314-223340336 GGCCTGTCCATTCTTCTGAGGGG + Intronic
924594932 1:245436608-245436630 TTACCCTCCATTCATGTGGGTGG - Intronic
1067685962 10:48466221-48466243 GTCCCCTCCGTAGTTCGGGGTGG + Intronic
1069149638 10:64942786-64942808 GTCCCTGCCATGCTTCTGAGTGG - Intergenic
1070398351 10:76032159-76032181 TTCCCCTCCATTCTGGTGAGTGG + Intronic
1070816999 10:79331078-79331100 GTCTCCTTCATTCTTCCAGGTGG - Intergenic
1073607542 10:104911328-104911350 GTCTCCTCCATGCCTCTGGCAGG - Intronic
1074327871 10:112470538-112470560 CTCCCATCCATTCTTCCAGGGGG - Intronic
1075587627 10:123669041-123669063 TTCCCCTCCATTCCTCTGGGAGG + Intronic
1076418743 10:130312760-130312782 ATCCCCTCCATTCTTCCAAGTGG - Intergenic
1076452507 10:130566540-130566562 GTTCACGCCATTCTCCTGGGAGG - Intergenic
1076802124 10:132835698-132835720 GACCCCTCCATCCCTGTGGGTGG + Intronic
1077725778 11:4673669-4673691 ATCCCCTCCATTTTCCTGTGAGG + Intergenic
1078170403 11:8925129-8925151 GTCTCCTCCTTTTTTCTTGGAGG - Intronic
1078771263 11:14354497-14354519 CTCCCCTCCTTACTTCTGTGTGG - Intronic
1078908759 11:15711598-15711620 GTCCCCCTCCTTCTTCTTGGAGG - Intergenic
1081735645 11:45401573-45401595 TCCCCCTGCATTCTCCTGGGAGG - Intergenic
1081875380 11:46404811-46404833 GTTCCTTTCATTCTTTTGGGGGG - Intronic
1082788798 11:57332968-57332990 GTCCACACCATCCTCCTGGGTGG + Exonic
1084685309 11:70690939-70690961 GTCTGCTTCATTCTTCTGGTGGG - Intronic
1086435393 11:86775078-86775100 GCCCACTCCATTCTTCAGAGTGG - Intergenic
1086950195 11:92883358-92883380 GTCCCAGCCATTCTTCCGGATGG - Exonic
1087321927 11:96672860-96672882 TTCCCCTCTCTTCTTCTGGTAGG + Intergenic
1087781466 11:102305292-102305314 GTTCCCTCCCTGCTTCTGGTTGG + Intergenic
1088889579 11:114033949-114033971 TTCCCCTGGATTCTTCTAGGAGG + Intergenic
1090470672 11:126978348-126978370 GTTTCCTCCATTCTTATGTGTGG + Intronic
1091602373 12:1925593-1925615 GCTCCCTCCATCCTCCTGGGTGG - Intergenic
1093678819 12:21976291-21976313 GTCCTCTCCCCACTTCTGGGTGG - Intergenic
1094217080 12:27954057-27954079 TTCTCCTCCCTTCCTCTGGGAGG + Intergenic
1098659271 12:73072447-73072469 GTCCCCTCCATGCTGGTGGCAGG - Intergenic
1100100120 12:91092511-91092533 TTCAGCTCCATGCTTCTGGGTGG + Intergenic
1103481425 12:121252619-121252641 GTCCCCTCAGTACTGCTGGGTGG - Intronic
1104616785 12:130277051-130277073 GGCCCCTCCAGTGTTTTGGGTGG - Intergenic
1105267967 13:18838123-18838145 GTCCACTCCATGCATGTGGGCGG - Intergenic
1112173634 13:96999125-96999147 GTAGCCTCCATACTCCTGGGCGG - Intergenic
1113485948 13:110652502-110652524 GCCCCCTCCTTTCTACTGGGTGG - Intronic
1115030197 14:28785432-28785454 TTCCCCTTCAGTCTTCAGGGAGG + Intronic
1115156909 14:30351680-30351702 GTGCCCTCCTTTCTTGTGAGAGG + Intergenic
1117733495 14:58747084-58747106 ATTCCCTCCATTCATCTGGAAGG + Intergenic
1117906179 14:60590990-60591012 TTCCTCTCCACTCTTCTGGTTGG - Intergenic
1122910443 14:104825357-104825379 GTCCCCAAGACTCTTCTGGGTGG + Intergenic
1123772429 15:23541634-23541656 CTCCACTCCATTCTCCAGGGAGG - Intergenic
1127638110 15:60890352-60890374 GTACTCTGCATTCTTCTGAGGGG - Intronic
1128538884 15:68511280-68511302 GTCTCCTCCATTCTTCTCCCTGG - Intergenic
1128838822 15:70832901-70832923 CACCCTTCCATTCTTCTGGGGGG + Exonic
1129728534 15:77916375-77916397 GGCCCCTCACCTCTTCTGGGAGG - Intergenic
1130018731 15:80209159-80209181 GTCTCCTGGATCCTTCTGGGTGG + Intergenic
1134590309 16:15447700-15447722 GTCACCTCCATTCTTCCTTGAGG - Intronic
1138041776 16:53679202-53679224 GTCCCCTCCATTCCTGTGGGTGG - Intronic
1147427016 17:40350747-40350769 GTCCCCTCCATTCCTGTCTGGGG - Intronic
1148162682 17:45460181-45460203 GTTCCCGCCTTTCTCCTGGGTGG - Intronic
1152088627 17:78234820-78234842 GTCCCCTGCTCCCTTCTGGGCGG + Intronic
1153333849 18:3901618-3901640 GTCCCCTACATCCTCATGGGTGG + Intronic
1155712501 18:28900334-28900356 TTCCTCTCCATTTTTCTGTGTGG + Intergenic
1156227018 18:35119191-35119213 CTGACCTCCGTTCTTCTGGGTGG + Intronic
1156592921 18:38511576-38511598 GTCCCCTCCCCTCCTCTGAGCGG - Intergenic
1159262629 18:66035153-66035175 GTCCTTTCCATTCTTCAGTGGGG + Intergenic
1160527693 18:79547113-79547135 TTCCCCTCTTTTCTTCTTGGTGG + Intergenic
1161057909 19:2199901-2199923 GCTCCCTCCACTCTTCTGAGAGG - Exonic
1163361061 19:16846755-16846777 GTCCCCACCATACTCCTGGACGG + Intronic
1163385596 19:16998067-16998089 ATCCCAGCCATTCTCCTGGGAGG - Intronic
1164952422 19:32348199-32348221 GTCCCCTGCCTTCTTTTGGCTGG + Intronic
1166672006 19:44716039-44716061 GTCCTCTCCATTCTTCAGCAGGG + Intergenic
1166792691 19:45407149-45407171 GTCCCCTCGTTTCTCCTTGGAGG + Exonic
1168081320 19:54012432-54012454 GTCCCCGCCAGTCTTCTCTGGGG - Exonic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925336404 2:3102138-3102160 GTCCCCTCCAGTGGTCTGGGCGG - Intergenic
928183835 2:29091482-29091504 CTCCCCACACTTCTTCTGGGAGG + Intergenic
928858283 2:35826613-35826635 TTCTCCTCCATTCTTCTGGTGGG - Intergenic
929246977 2:39712748-39712770 CTCTCCTCCATTCTTCTCTGAGG - Intronic
930768994 2:55113186-55113208 GCCCTCTCCTTTCTTCTGCGAGG + Intergenic
932087861 2:68777504-68777526 TTCTCCTCCTTACTTCTGGGAGG + Intronic
934881630 2:97986608-97986630 GTCCACCTCATTATTCTGGGTGG - Intronic
937438541 2:121898258-121898280 CTGCCCTCCATGCTGCTGGGAGG + Intergenic
937885404 2:126896297-126896319 GTCTCCTGGAATCTTCTGGGAGG - Intergenic
939036617 2:137139289-137139311 GTCACCTCCATTCTTTTAGATGG + Intronic
944388041 2:199186322-199186344 ATCCCCTCCCCCCTTCTGGGAGG + Intergenic
948471399 2:238182927-238182949 CTCCCCACGATGCTTCTGGGGGG - Intronic
949069248 2:242013516-242013538 CACCCCTCCATCCTTCTGCGGGG + Intergenic
1169335444 20:4752051-4752073 GTCTGCCCCATTCTTCTTGGAGG - Intergenic
1171152759 20:22842281-22842303 ATCCACTCCAATCTCCTGGGTGG - Intergenic
1174266583 20:49336427-49336449 GTCCCTTCCCTTATGCTGGGAGG + Intergenic
1176042483 20:63072711-63072733 GGCCCCTCCCTTCCTCTGTGGGG - Intergenic
1179480098 21:41671548-41671570 GACCCCTTCCTTCTGCTGGGAGG + Intergenic
1181495539 22:23285437-23285459 GTTCCCTTCATTTTTCTGGAGGG - Intronic
1182315742 22:29445787-29445809 GTCCCCCCCATTGTCCTTGGGGG + Intergenic
1182704739 22:32270062-32270084 GTCCACTCGCTTCTTCTGTGAGG - Intergenic
1183702658 22:39458528-39458550 CTCCCCTCCATCCTTCTGCTGGG - Intronic
1184159920 22:42692053-42692075 CTCCGCTCCATTCTTCTGACGGG - Intergenic
1185034562 22:48465342-48465364 TTTCCTTCCATTCTTCCGGGTGG - Intergenic
950520239 3:13493800-13493822 GTCCCGTGCATGCTCCTGGGTGG + Intronic
950707376 3:14791486-14791508 GTCACCTCCAGTCCACTGGGGGG + Intergenic
950881085 3:16323137-16323159 CTCTCCTCCATCCTTCTGGCCGG + Intronic
951143104 3:19191712-19191734 GTCCACTGCATTCTGCGGGGAGG + Intronic
951671865 3:25192380-25192402 TTCCCTTCCATTCATCAGGGAGG - Intronic
952827233 3:37534032-37534054 GTCCCTGCCATTTTTCTGGCTGG + Intronic
953189224 3:40668274-40668296 TTCCCCTCCATTCTTATGAAGGG + Intergenic
955087256 3:55715257-55715279 GTCCCCTGGATTCTTGGGGGAGG - Intronic
958831575 3:99097016-99097038 GTCCCCTCCATTCTTGGAAGAGG - Intergenic
964495587 3:157286478-157286500 GTCAGCTCCATTTTTCTAGGTGG - Intronic
964791237 3:160454258-160454280 TTCCCCACCATTTTTTTGGGTGG - Intronic
967170341 3:186818246-186818268 TGCCCCTGCACTCTTCTGGGTGG - Intergenic
969147741 4:5138952-5138974 GTCCCCTCCATTGCTCTCAGTGG - Intronic
969252213 4:5975470-5975492 GTCTCCTTCATTCTTCTTTGCGG + Intronic
971794234 4:31205615-31205637 GTTCCCTCTTTTCTTCTGGTTGG - Intergenic
974655418 4:64813116-64813138 GTCCTATCCATTCTACTGTGTGG + Intergenic
976275673 4:83274923-83274945 GTCCCCTCCATTCTGCTGTTGGG + Intronic
980768299 4:137336901-137336923 GACCATTCCCTTCTTCTGGGAGG - Intergenic
983188789 4:164732063-164732085 ATCGCCTCCATTCGTCTGTGAGG - Intergenic
995479753 5:112582318-112582340 GCCCCCTTCCTTCTTATGGGGGG - Intergenic
998107125 5:139475788-139475810 CTCCTCTCCATTCTTCTGCTGGG + Intronic
1001752181 5:174140077-174140099 GTCCCCTTGAGTTTTCTGGGAGG + Intronic
1003183994 6:3814647-3814669 GTGGCCACCATTCTACTGGGAGG + Intergenic
1003708498 6:8562310-8562332 TTCCCGTCCATTGTTCTGTGGGG + Intergenic
1006800945 6:36759383-36759405 GTCACCTCCCTTCTTCTTGGTGG + Intronic
1007031162 6:38628289-38628311 CTCCCCTGCTTTCTTCTGTGTGG - Intronic
1016803536 6:148190250-148190272 CTCCCCGGCTTTCTTCTGGGAGG - Intergenic
1018427245 6:163694509-163694531 GGTCCCTCCATCCTTCTAGGTGG - Intergenic
1019122499 6:169814234-169814256 GACCCCTCCATCCATCAGGGTGG - Intergenic
1019122522 6:169814312-169814334 GACCCCTCCATCCATCAGGGTGG - Intergenic
1019122584 6:169814585-169814607 GACCCCTCCATCCATCAGGGTGG - Intergenic
1019996000 7:4724950-4724972 GTCCCCACTATTTTTCTGTGTGG - Intronic
1020241525 7:6398935-6398957 GTCCCCTCCTTTCACTTGGGAGG - Intronic
1023969698 7:44981700-44981722 CCCCGCTCCATCCTTCTGGGAGG + Intergenic
1031942897 7:127808043-127808065 GCTCCCTCTATTCTTCTGGCTGG + Intronic
1032515890 7:132505969-132505991 GTCCCCTCCATTCTCCAGTCTGG + Intronic
1036577927 8:10045581-10045603 GTACCCTCCATACATCTGGAAGG + Intergenic
1037171803 8:15901443-15901465 GTACCCTCCATATTTCTGTGTGG - Intergenic
1038334046 8:26632150-26632172 GTCCTTTCCAATCCTCTGGGTGG - Intronic
1040339859 8:46435038-46435060 GAGCCCTCCGTGCTTCTGGGAGG + Intergenic
1043255424 8:78130763-78130785 GTTCCCTACATTTTGCTGGGGGG - Intergenic
1045240730 8:100398835-100398857 GCCCCTTGGATTCTTCTGGGAGG + Intronic
1046218868 8:111186323-111186345 GTACCAAGCATTCTTCTGGGAGG - Intergenic
1051713248 9:19954755-19954777 CTTCCCTACATTCTTCTGAGAGG + Intergenic
1055310465 9:74974191-74974213 CTCCCCTCCAGTCTCCAGGGTGG + Intergenic
1055875255 9:80934490-80934512 GTCTCCTCAACTCTTCTGGAGGG - Intergenic
1057249906 9:93492762-93492784 GTCCCCTAAATCCTTCTGAGTGG - Intronic
1058507189 9:105678004-105678026 GTCCCCTCCAGCCTTATGTGAGG - Intergenic
1060939641 9:127536019-127536041 GTCGCCACCCTTCTTCTGAGCGG - Intronic
1061687191 9:132291010-132291032 GTGCCCACCACTCTTCTAGGTGG - Intronic
1189298480 X:39935695-39935717 GTGGCCTCCAGGCTTCTGGGAGG - Intergenic
1189373519 X:40448486-40448508 CTGTCCTCCATTCTTCTGGCTGG + Intergenic
1192161947 X:68794924-68794946 GTCCACCCCTTCCTTCTGGGGGG + Intergenic
1195255350 X:103084382-103084404 TTCCCCTCCATTCTTCTCTCTGG + Exonic
1197706664 X:129639210-129639232 GTCCTCACCTTTCCTCTGGGAGG - Intergenic