ID: 919075915

View in Genome Browser
Species Human (GRCh38)
Location 1:192812710-192812732
Sequence AAGCCCATGCTGGTACTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919075915 Original CRISPR AAGCCCATGCTGGTACTTGT GGG (reversed) Intergenic
902540305 1:17149609-17149631 AAGCCCATGGTCGCACTTCTAGG - Intergenic
904090097 1:27938975-27938997 AAGGCCATGCTGGTAGGTGGTGG + Intronic
908994779 1:70138238-70138260 ATGCCCAAACTGGTACTTGAAGG - Intronic
917511366 1:175671842-175671864 CAGCCCAAGCTGGCACCTGTAGG + Intronic
918300188 1:183196965-183196987 AAGACCATGATAGTCCTTGTAGG + Intronic
918439881 1:184556181-184556203 AAGCTGATGCAGGTACTTGTTGG + Intronic
919075915 1:192812710-192812732 AAGCCCATGCTGGTACTTGTGGG - Intergenic
921733922 1:218605089-218605111 AAGCCCATCCTAGTAGTTTTTGG + Intergenic
922182209 1:223244224-223244246 AAGCATATGCTGGTACTAGCAGG + Intronic
1069346871 10:67480471-67480493 ATGCCCATGCTGGAAGTTGCCGG + Intronic
1076168825 10:128303562-128303584 GTGCCCATGCTGGTGGTTGTTGG - Intergenic
1076245366 10:128943236-128943258 GAGCCCATGCTGGGAGTGGTTGG - Intergenic
1080631322 11:34079685-34079707 CAGCCCATTCTGGTGGTTGTGGG - Exonic
1081861608 11:46336223-46336245 CAGCCCATGCTGGCACTGGGAGG - Intronic
1083535155 11:63460374-63460396 AACCCCATGCTGCTGCTTCTTGG - Intergenic
1095576072 12:43740882-43740904 AAGCTCATGCTCGTGGTTGTTGG - Intronic
1095627316 12:44331441-44331463 AAGCCCATGATGGTGTTTCTTGG + Intronic
1096354925 12:50932666-50932688 AAACCCATTCTGATACTTCTAGG - Intergenic
1113706491 13:112436713-112436735 ATGCCCATCCTAGTACATGTGGG - Intergenic
1115765960 14:36624212-36624234 AGGCCCATGTTGGTCCCTGTGGG - Intergenic
1117616293 14:57536936-57536958 AAACCCATGTTGGTCCATGTTGG + Intergenic
1123962975 15:25425888-25425910 GAGCCCATGCTGGTAAATCTGGG + Intronic
1127751834 15:62053391-62053413 AGGCTCATGCTGATATTTGTGGG - Intronic
1141805510 16:86338876-86338898 AAGCCCATGCTGGGACAGGTGGG - Intergenic
1144187446 17:12809814-12809836 AAGGCCATGGTGGAACTTGCGGG + Intronic
1145787503 17:27603677-27603699 GGGCCCAGGCTGGTCCTTGTGGG + Intronic
1151722994 17:75868791-75868813 AAGCCCCTGGTGGTCCTTGTGGG - Intergenic
1154263515 18:12859149-12859171 AAGCCCATGTAAGTACTTGTGGG - Exonic
1156467063 18:37354362-37354384 AAGCCCATGCTTCTGATTGTGGG + Intronic
1163437600 19:17304659-17304681 AACCCCAAGCTGGCACTTGTAGG + Intronic
1164295297 19:23904469-23904491 ATGCCCATGCTGAAAGTTGTGGG + Intergenic
1165578147 19:36838920-36838942 TATCCCAGGCTGGTACTTGTGGG - Intronic
1166154569 19:40901241-40901263 AAGACTACGCTGGCACTTGTTGG - Intergenic
1166173547 19:41049350-41049372 AAGACTACGCTGGCACTTGTTGG + Intergenic
929506959 2:42535793-42535815 AAGCTCATGCTGGAAGCTGTAGG - Intronic
934256848 2:91430626-91430648 AAAACCATGATGGTAATTGTGGG + Intergenic
935087038 2:99858197-99858219 CAGCCCAGGCTGGAACTGGTTGG - Intronic
937473567 2:122194477-122194499 AAACCCATGCTGGTTGTGGTGGG + Intergenic
938780746 2:134582612-134582634 AAGCCCAAGCTGGTGCATGGTGG + Intronic
940029174 2:149242336-149242358 AAGAACATTCTGTTACTTGTAGG + Intergenic
947538794 2:230960022-230960044 AAGCCCAGGCATGTACTGGTGGG - Intronic
1177730193 21:25019185-25019207 ATGCCTATGCTGGTACTCTTTGG - Intergenic
1179178577 21:39026424-39026446 AAGCACCTGCTGGTCCTTTTTGG - Intergenic
1182031217 22:27160900-27160922 AAGCCCATGCTCCAAATTGTTGG + Intergenic
1182880950 22:33732848-33732870 AGGCCCATTCTGGGACTTGAAGG - Intronic
1184276651 22:43412550-43412572 AAGCCCCTGCTGGCACTTGGGGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950345933 3:12292969-12292991 AGGCTCATGCTGGTGCGTGTAGG + Intronic
950521979 3:13502682-13502704 AAGCCCATGCTAGAAGGTGTCGG + Intronic
954538372 3:51378014-51378036 AAGCTCATGCTGCATCTTGTAGG + Intronic
954749403 3:52805175-52805197 ATGCCCATGCTGGGAATTGCTGG + Intronic
955101134 3:55851189-55851211 AAGCCCATGCTGGGAGTTGGTGG + Intronic
956990460 3:74756997-74757019 CAGCCCATGCTGGTTTCTGTTGG - Intergenic
958151793 3:89701594-89701616 AAGTCCAGGCTGAGACTTGTTGG - Intergenic
960216211 3:115041054-115041076 AAGCCCATGTTGGTGCATGATGG + Intronic
962615806 3:137125357-137125379 AAGCCCATGCTTGTGGTGGTTGG + Intergenic
962776647 3:138667321-138667343 AAGACCATGCAGGTTCCTGTTGG + Intronic
966690740 3:182738878-182738900 AAGTCCAAGCTGGTACCTGTAGG - Intergenic
967466203 3:189808557-189808579 AAGCCCATCCTTGGACTTGGGGG - Intronic
968007162 3:195250996-195251018 AAGCCTAGGTTGGTCCTTGTGGG - Intronic
971177634 4:24294966-24294988 AAGCCCATGGGGGGACTAGTAGG + Intergenic
971202595 4:24525114-24525136 AAGGCCATTCTGCTACTTGATGG - Intronic
975516519 4:75254115-75254137 TAGCCCCTGCTGGTCCTTCTTGG - Intergenic
977028315 4:91849185-91849207 ATTCCCATGCTGGTGCTTCTTGG + Intergenic
977710289 4:100116568-100116590 AAGCTCAAGCTGTTAATTGTTGG - Intergenic
989810533 5:45667284-45667306 AGACCCATGCTGGTCCTGGTGGG + Intronic
991083319 5:62624392-62624414 AATGCCATGGTGGTATTTGTAGG - Intronic
995478236 5:112569388-112569410 AAGCCCATGTATGTTCTTGTTGG - Intergenic
996878543 5:128266983-128267005 AAGCACATGCTGGGGCCTGTTGG - Intronic
999866278 5:155703645-155703667 TTGCTCCTGCTGGTACTTGTTGG + Intergenic
1001216166 5:169858134-169858156 AACCCCATGGTGGTACATGATGG + Intronic
1004556674 6:16705137-16705159 GAGCCTATGCTGGGACTTGGGGG + Intronic
1013529752 6:111008062-111008084 AAACCCATGCTGATATTTGCTGG + Exonic
1017778184 6:157695731-157695753 AAGCTCATGCTGGTGCTTGTGGG - Intergenic
1019999712 7:4748752-4748774 TTGCCCAGGCTGGTACTTCTGGG + Intronic
1024059797 7:45689386-45689408 AAGCAGATGCTGGTGCCTGTTGG - Intronic
1026555758 7:71407370-71407392 ACCCCCATGCTGGTAATTGATGG - Intronic
1027880671 7:83831223-83831245 AAGCCCATTCTTGTGGTTGTTGG - Intergenic
1030192103 7:106820415-106820437 AAGCCCTTGCTGTGACTTGTGGG - Intergenic
1041415138 8:57599724-57599746 AATCTCCTGCTGGTACTTTTAGG - Intergenic
1042085811 8:65107460-65107482 AAGCGCAGGCTGGAACTTTTGGG - Intergenic
1048831055 8:138477988-138478010 TGGCTCATGCTGCTACTTGTGGG - Intronic
1049032695 8:140049222-140049244 AAGCCCATGCTGGGGCCTGCGGG + Intronic
1055667347 9:78566060-78566082 AATGCCAAGCTGGTACTTGTGGG - Intergenic
1059645727 9:116264937-116264959 AAGCCCAAGCAGGTACTAGGAGG + Intronic
1061013012 9:127966458-127966480 AAGCCCATGCAGGCAGGTGTGGG + Intronic
1062209807 9:135357346-135357368 AAGCCCATGCAGGACCCTGTGGG - Intergenic
1187896242 X:23982183-23982205 ATGCCCAGGCTGGTTCTTGAAGG + Intergenic
1189112873 X:38311811-38311833 AAGCCCATTCTGTTGCTTCTAGG - Intronic
1196622523 X:117839731-117839753 CTGCCCCTGCTGGCACTTGTAGG + Intergenic
1196840102 X:119852198-119852220 AAGCCAACGCTGGTCTTTGTGGG + Intronic