ID: 919077495

View in Genome Browser
Species Human (GRCh38)
Location 1:192831034-192831056
Sequence TGGAAGGTAGAGCACATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919077490_919077495 0 Left 919077490 1:192831011-192831033 CCTGGTAGAGAAGTACTGAGTCC No data
Right 919077495 1:192831034-192831056 TGGAAGGTAGAGCACATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919077495 Original CRISPR TGGAAGGTAGAGCACATTGG AGG Intergenic
No off target data available for this crispr