ID: 919085651

View in Genome Browser
Species Human (GRCh38)
Location 1:192917624-192917646
Sequence TCTCAGAGACTGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919085651_919085657 11 Left 919085651 1:192917624-192917646 CCTACCTCCCTCAGTCTCTGAGA No data
Right 919085657 1:192917658-192917680 AAGAGCTTATCCTCAATCACAGG No data
919085651_919085659 26 Left 919085651 1:192917624-192917646 CCTACCTCCCTCAGTCTCTGAGA No data
Right 919085659 1:192917673-192917695 ATCACAGGTACTCCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919085651 Original CRISPR TCTCAGAGACTGAGGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr