ID: 919085898

View in Genome Browser
Species Human (GRCh38)
Location 1:192919678-192919700
Sequence CAACATCACTTTAGTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919085898_919085908 22 Left 919085898 1:192919678-192919700 CCATGTTCACTAAAGTGATGTTG No data
Right 919085908 1:192919723-192919745 AAGGAGCTTACATAAGAGGAAGG No data
919085898_919085900 3 Left 919085898 1:192919678-192919700 CCATGTTCACTAAAGTGATGTTG No data
Right 919085900 1:192919704-192919726 TTCTCCACCCCTGACCCTGAAGG No data
919085898_919085907 18 Left 919085898 1:192919678-192919700 CCATGTTCACTAAAGTGATGTTG No data
Right 919085907 1:192919719-192919741 CCTGAAGGAGCTTACATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919085898 Original CRISPR CAACATCACTTTAGTGAACA TGG (reversed) Intergenic
No off target data available for this crispr