ID: 919090780

View in Genome Browser
Species Human (GRCh38)
Location 1:192976923-192976945
Sequence GCAGCTCAGAACCTATTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919090780_919090783 24 Left 919090780 1:192976923-192976945 CCCAAAAATAGGTTCTGAGCTGC No data
Right 919090783 1:192976970-192976992 TTCACACCCCCTAATTCGCTGGG No data
919090780_919090782 23 Left 919090780 1:192976923-192976945 CCCAAAAATAGGTTCTGAGCTGC No data
Right 919090782 1:192976969-192976991 ATTCACACCCCCTAATTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919090780 Original CRISPR GCAGCTCAGAACCTATTTTT GGG (reversed) Intergenic
No off target data available for this crispr