ID: 919091322

View in Genome Browser
Species Human (GRCh38)
Location 1:192981557-192981579
Sequence AAACCCTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919091322_919091324 18 Left 919091322 1:192981557-192981579 CCTATCTTTGTGAAGCAGGGTTT No data
Right 919091324 1:192981598-192981620 AAATAAGATTCCAGAGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919091322 Original CRISPR AAACCCTGCTTCACAAAGAT AGG (reversed) Intergenic