ID: 919093584

View in Genome Browser
Species Human (GRCh38)
Location 1:193002492-193002514
Sequence TGCCCGAGAGGCGGAGGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919093584_919093588 14 Left 919093584 1:193002492-193002514 CCGCAACCTCCGCCTCTCGGGCA No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG No data
919093584_919093592 23 Left 919093584 1:193002492-193002514 CCGCAACCTCCGCCTCTCGGGCA No data
Right 919093592 1:193002538-193002560 TCCTGAGTAGCTGGGACTACAGG No data
919093584_919093590 15 Left 919093584 1:193002492-193002514 CCGCAACCTCCGCCTCTCGGGCA No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919093584 Original CRISPR TGCCCGAGAGGCGGAGGTTG CGG (reversed) Intergenic