ID: 919093585

View in Genome Browser
Species Human (GRCh38)
Location 1:193002498-193002520
Sequence CGCTTGTGCCCGAGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919093585_919093590 9 Left 919093585 1:193002498-193002520 CCTCCGCCTCTCGGGCACAAGCG No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
919093585_919093588 8 Left 919093585 1:193002498-193002520 CCTCCGCCTCTCGGGCACAAGCG No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
919093585_919093592 17 Left 919093585 1:193002498-193002520 CCTCCGCCTCTCGGGCACAAGCG No data
Right 919093592 1:193002538-193002560 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919093585 Original CRISPR CGCTTGTGCCCGAGAGGCGG AGG (reversed) Intergenic
No off target data available for this crispr