ID: 919093587

View in Genome Browser
Species Human (GRCh38)
Location 1:193002504-193002526
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919093587_919093592 11 Left 919093587 1:193002504-193002526 CCTCTCGGGCACAAGCGATTCTC No data
Right 919093592 1:193002538-193002560 TCCTGAGTAGCTGGGACTACAGG No data
919093587_919093590 3 Left 919093587 1:193002504-193002526 CCTCTCGGGCACAAGCGATTCTC No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG No data
919093587_919093588 2 Left 919093587 1:193002504-193002526 CCTCTCGGGCACAAGCGATTCTC No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919093587 Original CRISPR GAGAATCGCTTGTGCCCGAG AGG (reversed) Intergenic