ID: 919093588

View in Genome Browser
Species Human (GRCh38)
Location 1:193002529-193002551
Sequence GCCTCAGCCTCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919093586_919093588 5 Left 919093586 1:193002501-193002523 CCGCCTCTCGGGCACAAGCGATT No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG No data
919093585_919093588 8 Left 919093585 1:193002498-193002520 CCTCCGCCTCTCGGGCACAAGCG No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG No data
919093584_919093588 14 Left 919093584 1:193002492-193002514 CCGCAACCTCCGCCTCTCGGGCA No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG No data
919093587_919093588 2 Left 919093587 1:193002504-193002526 CCTCTCGGGCACAAGCGATTCTC No data
Right 919093588 1:193002529-193002551 GCCTCAGCCTCCTGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919093588 Original CRISPR GCCTCAGCCTCCTGAGTAGC TGG Intergenic