ID: 919093590

View in Genome Browser
Species Human (GRCh38)
Location 1:193002530-193002552
Sequence CCTCAGCCTCCTGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919093585_919093590 9 Left 919093585 1:193002498-193002520 CCTCCGCCTCTCGGGCACAAGCG No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG No data
919093586_919093590 6 Left 919093586 1:193002501-193002523 CCGCCTCTCGGGCACAAGCGATT No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG No data
919093584_919093590 15 Left 919093584 1:193002492-193002514 CCGCAACCTCCGCCTCTCGGGCA No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG No data
919093587_919093590 3 Left 919093587 1:193002504-193002526 CCTCTCGGGCACAAGCGATTCTC No data
Right 919093590 1:193002530-193002552 CCTCAGCCTCCTGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919093590 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG Intergenic