ID: 919094224

View in Genome Browser
Species Human (GRCh38)
Location 1:193010466-193010488
Sequence ATCCTAGATCTACTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 6, 3: 62, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919094224 Original CRISPR ATCCTAGATCTACTACTTAC TGG Intergenic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
902666219 1:17940516-17940538 TTCCTGGATTTACAACTTACTGG - Intergenic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905945677 1:41899849-41899871 ATTCTAGACCTACTACTTACAGG - Intronic
906209079 1:44002377-44002399 CTCCCAGATCTTCTACTCACTGG - Exonic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906666257 1:47624219-47624241 ATCCCAGCTCTACCACTTCCTGG - Intergenic
907810575 1:57865763-57865785 AGCATAGATCTACTACCTACTGG + Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908172924 1:61525655-61525677 ATCCTAGCTCTACCACTTCCTGG + Intergenic
908172967 1:61526291-61526313 ATCCTAGCCCTACCACTTCCTGG - Intergenic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908807825 1:67949085-67949107 ATCTTAGATGTCCTGCTTACAGG + Intergenic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
908872970 1:68635678-68635700 ATCCTATCTGTATTACTTACTGG + Intergenic
909894616 1:81051821-81051843 ATGCCAGCTCCACTACTTACAGG - Intergenic
911173842 1:94798650-94798672 ATCCTAGCTCTGCAACTTCCCGG + Intergenic
911777956 1:101839084-101839106 ATCCTTGATCTATTACGTAAAGG + Intronic
912699919 1:111869820-111869842 AACCTGGATCCACCACTTACTGG - Intronic
913373298 1:118124782-118124804 ATCCCATCTCTACTAATTACCGG - Intronic
914216445 1:145634619-145634641 ATCCTTGATCTAAAACTTAATGG + Intronic
914469016 1:147957277-147957299 ATCCTTGATCTACAACTTAATGG + Intronic
914686814 1:149987393-149987415 ATCCCAGAGCTACTATTTAAGGG + Intronic
914878813 1:151532205-151532227 ATCCTGGCTCTACCACTTACTGG - Intronic
915938814 1:160105437-160105459 ATCCTAGGTCTACCACTAATTGG - Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
917525807 1:175787566-175787588 ATCCCAGCTCTACCACTGACTGG - Intergenic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
917954651 1:180082048-180082070 ATCCTGGATCTCTTACTTACCGG + Intronic
918402295 1:184175607-184175629 TTCCTGGCTTTACTACTTACTGG + Intergenic
918974091 1:191458405-191458427 ACCCTAGATCTGCCACATACTGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919506274 1:198401388-198401410 ATCCTGGCTCCACTACTAACTGG - Intergenic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
920409926 1:205750929-205750951 ATCCCAGGTCCACTACTTAATGG + Intergenic
920968774 1:210724358-210724380 ATCCTAACTCTACTGCTTACTGG - Intronic
921123060 1:212153369-212153391 ACCCTAGCTCAACCACTTACTGG + Intergenic
921501113 1:215904514-215904536 ATCCTAGATTTAATCCTTAGAGG + Intronic
921544449 1:216457664-216457686 ATCTTAGTTCTACCATTTACTGG + Intergenic
922130151 1:222769689-222769711 ATCTTAGATCTGCCACTTGCTGG - Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
923658202 1:235936736-235936758 ATCCCAGCTCTTCCACTTACTGG - Intergenic
924208778 1:241743418-241743440 ATCCCAGCTCTACCACTTCCCGG + Intronic
924820799 1:247488358-247488380 ATCATAGGTCTTCTACTTTCTGG + Intergenic
1067543988 10:47178679-47178701 ATCCTGAATCTACCACTTAGTGG + Intergenic
1069544212 10:69317697-69317719 ATCCTAGATCTACAACTTCCTGG + Intronic
1069546168 10:69330437-69330459 ATCCTAGCTCTTCTGCTTTCTGG - Intronic
1069858793 10:71457411-71457433 ATCCTGACTCTACTGCTTACTGG - Intronic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1071255308 10:83866998-83867020 ATTCTAGCTCTACCACTTAATGG + Intergenic
1071873079 10:89816218-89816240 ATCCTAGATCTACTGCTTACTGG - Intergenic
1072910717 10:99498395-99498417 ATCTCAGTTCTACCACTTACTGG - Intergenic
1072959427 10:99915861-99915883 ATCTCAGCTCTTCTACTTACTGG - Intronic
1073803374 10:107068490-107068512 ATGCTAGTTCAAATACTTACTGG - Intronic
1075633918 10:124017711-124017733 GTCCTAGATCCTCTGCTTACTGG + Intronic
1076453636 10:130574498-130574520 AAACTAGATCTATTTCTTACTGG - Intergenic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1078747928 11:14133019-14133041 ATCCTAGCATTACCACTTACTGG - Intronic
1079050521 11:17153466-17153488 TTGCTATATCTACTAGTTACAGG - Intronic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079475819 11:20828084-20828106 ATCTTGGATCTACCACTTACTGG + Intronic
1079913109 11:26335150-26335172 ATCCAATATATTCTACTTACAGG + Intronic
1080267983 11:30421647-30421669 ATCTTGGCTCTACTACTTACTGG - Intronic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1081581956 11:44358700-44358722 ATTCCAGCTCTACCACTTACCGG - Intergenic
1081962520 11:47148847-47148869 GTCCTAGTTCCACTACTCACTGG - Intronic
1083050615 11:59773016-59773038 ATCCTAGCTCTACCAATTGCTGG - Intronic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085951454 11:81337394-81337416 TCCCTAGATGTGCTACTTACTGG - Intergenic
1086158210 11:83692073-83692095 AACTCAGATCTACCACTTACCGG - Intronic
1086978735 11:93169320-93169342 ATCCTAGAACCACCACTTACTGG - Intronic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1088148645 11:106716436-106716458 ATCCTGGCTCTACTACTTAACGG + Intronic
1088157750 11:106829406-106829428 AGCCTAGTTCCACTACTTGCTGG + Intronic
1088283256 11:108159507-108159529 ATCCTGCATCTACTGCTTATTGG - Intronic
1088283386 11:108160702-108160724 ATCCTGCATCTACTGCTTATTGG + Intronic
1088437587 11:109832303-109832325 ATCCTATCTCTCCTACTTACTGG - Intergenic
1088632265 11:111785140-111785162 GTCCCAGCTCTATTACTTACTGG + Intronic
1088735699 11:112725966-112725988 ATCCCAGCTCTACTACTTTCTGG + Intergenic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1090233518 11:125128007-125128029 ATCCTGGCTCTACCCCTTACTGG + Intergenic
1090478888 11:127050176-127050198 ATCCTGACTCTACTACTTACTGG - Intergenic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1090976425 11:131684025-131684047 ATTCTAACTCTACTACTTACTGG + Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1091914208 12:4256505-4256527 ATCCTGGCTCTACCACTTATTGG - Intergenic
1092236281 12:6812062-6812084 ATCCTAGCTCCACCACTTACGGG + Intronic
1094008692 12:25783738-25783760 ATCATCGTTCCACTACTTACAGG - Intergenic
1094332365 12:29308345-29308367 ATTCCAGCTCCACTACTTACTGG + Intronic
1094464597 12:30738372-30738394 ATCTTGGCTCTACCACTTACTGG + Intronic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1094764963 12:33583839-33583861 ATACAAGTTCTGCTACTTACTGG - Intergenic
1095732086 12:45517184-45517206 ATCATGGATCTACTGCTGACTGG - Intergenic
1096088798 12:48884390-48884412 ATCCCAGCTCTTCCACTTACCGG - Intergenic
1096244991 12:49979539-49979561 ATCTTCGATCTACTACCTCCAGG + Intronic
1096551244 12:52373347-52373369 ATCCCAGGTCTTCCACTTACTGG - Intergenic
1097168391 12:57098309-57098331 ATTCTAGCTCCACCACTTACTGG - Intronic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097760224 12:63456166-63456188 ATTCGAGACCCACTACTTACTGG + Intergenic
1098448421 12:70591365-70591387 ATTCTAGCTCTACCACTTACTGG + Intronic
1099948550 12:89273693-89273715 ATCCTAGCTCCACCACTTACTGG - Intergenic
1100757038 12:97762833-97762855 AACCTGGCTCTACCACTTACTGG - Intergenic
1100865893 12:98856375-98856397 ATCCTAGCTCTAATATGTACAGG + Intronic
1101406784 12:104435796-104435818 TTCCTAGTTCTACCACTTACTGG - Intergenic
1101511849 12:105400355-105400377 ATCCCAGTTCTTTTACTTACTGG + Intergenic
1102076168 12:110061890-110061912 ATCTCAGCTCTACCACTTACTGG + Intronic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102446958 12:113010386-113010408 ATCCTAGCTCCACAACTTCCTGG - Exonic
1103428994 12:120865403-120865425 ATCCTGGGTCTACCACTTACTGG + Intronic
1103970988 12:124671315-124671337 ATCCCAGATCTGCCACTCACTGG - Intergenic
1105972765 13:25445907-25445929 TTCCCAGCGCTACTACTTACTGG + Intronic
1106561832 13:30853428-30853450 ATCCTGCCTCTACTGCTTACTGG - Intergenic
1107619731 13:42213947-42213969 ATCCTGGCTCTACGATTTACTGG + Intronic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1109441734 13:62383376-62383398 ACCCTAGAAATACAACTTACTGG + Intergenic
1110166960 13:72454068-72454090 ATCTTGACTCTACTACTTACTGG + Intergenic
1111091170 13:83450126-83450148 ATCCTAGATCTCCTGCTGCCTGG + Intergenic
1112229599 13:97575162-97575184 ATCCCAGATCTTCTACTCACTGG + Intergenic
1114461570 14:22889393-22889415 ATCCCAACTCTACTGCTTACCGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115604779 14:34989967-34989989 ATCCTAGCTCTGTTACATACTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1116484168 14:45426968-45426990 ATCCTAGTTCTAGTACCTCCTGG + Intergenic
1116810263 14:49533352-49533374 AAGCTAGATCTACAACTCACTGG - Intergenic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1119848511 14:77848300-77848322 ACCCTGAATCTACTATTTACTGG + Intronic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1120417116 14:84233478-84233500 ATCCTAGCTCCATTACTGACTGG - Intergenic
1120499239 14:85274030-85274052 ATTCTAGTTCTACTGCTAACTGG - Intergenic
1120532910 14:85655982-85656004 AGCCTAGCTCTACCACTTCCTGG + Intergenic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121884464 14:97530702-97530724 ATTTTAGATCTGCCACTTACTGG + Intergenic
1122489822 14:102107031-102107053 AGCATAGATCTACTGCTTAGGGG + Intronic
1124835133 15:33189235-33189257 ATCCTCTACCTTCTACTTACAGG - Intronic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125386019 15:39137458-39137480 AACCCAGATATACCACTTACTGG - Intergenic
1125768795 15:42151798-42151820 ACCCTGGCTCTACTACTTACTGG + Intronic
1126067755 15:44838906-44838928 ATCCTGGATCTACTCCCTCCTGG - Intergenic
1126092122 15:45061976-45061998 ATCCTGGATCTACTCCCTCCTGG + Intronic
1126349246 15:47727528-47727550 GTCTTAGATCTACTACTGAGTGG - Intronic
1127698771 15:61476799-61476821 GTCCTTGTTTTACTACTTACTGG - Intergenic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1129294106 15:74590328-74590350 ATCTCAGCTCTACCACTTACTGG - Intronic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129645555 15:77427927-77427949 ATCCTGTCTCTACCACTTACTGG - Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129915014 15:79261164-79261186 ATCGTGGATCTGCTACTTGCTGG + Intergenic
1129949938 15:79576768-79576790 ATCCCAGCTCCTCTACTTACTGG + Intergenic
1130158836 15:81378332-81378354 TTCCTAGACCCACTGCTTACAGG + Intergenic
1131027640 15:89158272-89158294 CTCTTAGCTCTTCTACTTACTGG - Intronic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1134811496 16:17170879-17170901 GTCCTAGTTCTACTACTTATTGG + Intronic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1137873316 16:51971609-51971631 ATCCTGGCTCCACTACTTAGTGG - Intergenic
1137904588 16:52307669-52307691 ATCCCAGCTCTACCACTTACCGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138344615 16:56312223-56312245 ATCCCAGCTCTACCACCTACTGG + Intronic
1138542220 16:57695330-57695352 ATCCCAGACCTGCTACTTACTGG + Intronic
1138557649 16:57781853-57781875 GTCCTAGGTCCACCACTTACTGG - Intronic
1142928103 17:3258910-3258932 TTCCTAGTTCTACTACTAATGGG - Intergenic
1143701514 17:8664114-8664136 ATCCTAGTTCTCCCACTTCCTGG - Intergenic
1144220508 17:13095507-13095529 AGCCTGGTTCTACTTCTTACTGG + Intergenic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1144541824 17:16150562-16150584 ATCCTAGATGGACTACTGACTGG - Intronic
1145413770 17:22695519-22695541 ATCCTAGCTCTACTGTTCACAGG - Intergenic
1148617231 17:49010231-49010253 ATCACAGCACTACTACTTACTGG - Intronic
1152979339 18:260689-260711 ATCCCAGCTCTACCACTTACTGG - Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1153403836 18:4712240-4712262 ATCCAAGCTCCACTGCTTACTGG - Intergenic
1154329364 18:13417020-13417042 AAGCTGGCTCTACTACTTACTGG - Intronic
1155240026 18:23856138-23856160 ATCCCAACTCTACCACTTACTGG - Intronic
1155528336 18:26740369-26740391 TTCCTGGTTCTACCACTTACTGG + Intergenic
1155674372 18:28411651-28411673 ATGCTAAATCTGCTACTTATTGG - Intergenic
1158694578 18:59692404-59692426 ATCCCAGCTCTACTACTTGGTGG - Intronic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1162859702 19:13497001-13497023 ATCCCAGCTCTACTAGTCACTGG - Intronic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1163018003 19:14468507-14468529 ATCCTGGACCTGCTGCTTACTGG - Intronic
1164759188 19:30715849-30715871 ACCCTAGCTTTATTACTTACTGG + Intergenic
1165729875 19:38138279-38138301 ATCCAACTTCTACTTCTTACTGG + Intronic
1166625281 19:44346214-44346236 ATCCTGACTCTACCACTTACTGG + Intronic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167529209 19:50004480-50004502 ATCCCAGCTCTACTACTTCCAGG + Intronic
1167531207 19:50018080-50018102 ATCCCAGATCTGCTACATGCTGG + Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
926575842 2:14580143-14580165 ATTCTAGATCTACCATGTACTGG + Intergenic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927727707 2:25439680-25439702 ATCCTAGCTTTGCTACTTTCTGG + Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
928611249 2:32994395-32994417 ATCTTGGTTCTACCACTTACTGG - Intronic
928914648 2:36458074-36458096 ATACTGGATCTACTACACACCGG - Intronic
929973338 2:46605743-46605765 ATCCCAGCTCTACTACTTCCTGG + Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
932060035 2:68487397-68487419 ATCCTGGCCCTACTACTTATTGG + Intronic
932411848 2:71552270-71552292 ATCCTGGCTCTAGCACTTACCGG + Intronic
933748275 2:85586208-85586230 CTCCCAGATCTTCTACTCACTGG + Intronic
935366125 2:102292738-102292760 GTCCTAGCTCTACTACTTACTGG - Intergenic
940334900 2:152515960-152515982 ATCCTGACTCTACTAATTACGGG - Intronic
941092681 2:161196513-161196535 ATCTTAGCTCTACTATCTACTGG + Intronic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
942047196 2:172106625-172106647 TTCCTAGAGCTACTACTTCGGGG - Intergenic
943976901 2:194493434-194493456 ATCCTAGCTTTACCACTTGCTGG - Intergenic
944468961 2:200032733-200032755 TTCCCAGTTCTACCACTTACTGG - Intergenic
944985673 2:205173364-205173386 ATCCTAGATTTGCTATTTCCTGG + Intronic
945135719 2:206625705-206625727 ATCCCAGCTCTACCACTAACTGG - Intergenic
945673146 2:212826231-212826253 CTCATAGAGCTACCACTTACTGG + Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
946765715 2:223038179-223038201 ATCCTAGTTCTACCGGTTACTGG - Intergenic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
948501042 2:238394760-238394782 ATCCTAGTTCCACCATTTACTGG - Intronic
1168840915 20:909728-909750 ATCCCAGCTCCACTGCTTACTGG - Intronic
1168990304 20:2089586-2089608 ATCCCAGTTCTACCACTTGCTGG + Intergenic
1169303350 20:4465936-4465958 ATCCTAGATCTTCTGCTTCTTGG + Intergenic
1170377701 20:15718722-15718744 ATCTTAGATCCATGACTTACGGG + Intronic
1170394651 20:15912982-15913004 ATCCCAGCTCTACCACTGACTGG + Intronic
1172995181 20:39065037-39065059 ATCCTGGATTTGCTACTCACTGG + Intergenic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173458946 20:43226372-43226394 ATTCTAGCTCTTCTACATACTGG - Intergenic
1173692466 20:44973669-44973691 ATCCTTGCTCTACTGTTTACTGG + Intronic
1173833106 20:46105389-46105411 ATCCTGGCTCTACCATTTACTGG + Intergenic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174776657 20:53349151-53349173 ATCCTTGCTCTACCACTAACTGG + Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1178215152 21:30588241-30588263 ATCCTACATATACAACTTAATGG + Intergenic
1181623752 22:24108211-24108233 ATCCCAGATCTGCCACTTAGGGG - Intronic
1181865843 22:25854430-25854452 ATCCCAGCTCTACTACTACCTGG - Intronic
949094403 3:68829-68851 ATCCTAGCCTTACTATTTACTGG + Intergenic
949300029 3:2573078-2573100 ATCTTAGCTCGACCACTTACTGG - Intronic
949501832 3:4687457-4687479 ATCCCAGATCTCCAACTTCCTGG - Intronic
949711783 3:6879205-6879227 ATTTTTAATCTACTACTTACTGG - Intronic
949829592 3:8199627-8199649 ATCCCAGTTCTACTACTTACTGG + Intergenic
950188626 3:10960870-10960892 ATCCTGGATCCATTACTCACAGG + Intergenic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
950755550 3:15168511-15168533 ATCCTAGATTTGGCACTTACTGG - Intergenic
951696200 3:25448119-25448141 ATCCTCACTCTCCTACTTACTGG - Intronic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
953002482 3:38948521-38948543 ATCCTAGCTCCACCACTCACTGG + Intronic
954065178 3:48100155-48100177 GTTCCAGATCTACCACTTACTGG - Intergenic
954762844 3:52889494-52889516 TGCCTAGCTCTACCACTTACTGG + Intronic
956051810 3:65256126-65256148 TTCCTAGTTCTACCACTTACTGG + Intergenic
958709447 3:97699518-97699540 ATCCTAGCTCCACAACTTATGGG - Intronic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961237440 3:125379358-125379380 ATCCTGACTCTACCACTTACTGG + Intergenic
962464175 3:135641347-135641369 ATCCGAGCTCTACCACTCACTGG - Intergenic
964154346 3:153565783-153565805 ATCCCCGATTTACCACTTACAGG + Intergenic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
966054641 3:175670173-175670195 ATCCTAGTTTTGCTACTTTCTGG - Intronic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
966819274 3:183912147-183912169 ATCCCAGATCTATCTCTTACTGG + Intergenic
968255365 3:197264988-197265010 TGCATAGATCTAATACTTACAGG + Intronic
969286914 4:6208324-6208346 ATCCTGGCTCTACCACTTTCCGG - Intergenic
970384170 4:15539355-15539377 ATGATAGATCTTCTATTTACTGG - Intronic
970457385 4:16238563-16238585 CTACTAGATCTACCACTCACAGG + Intergenic
970490271 4:16565150-16565172 ATCTCAGACCTACCACTTACTGG + Intronic
971426618 4:26522188-26522210 ATCCCAGTTCTACCACTCACTGG - Intergenic
971524134 4:27594595-27594617 ATCTTGGTTCTACCACTTACTGG + Intergenic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
973959229 4:56093048-56093070 GTGCTAGATCCACTACTTACTGG + Intergenic
976099685 4:81548172-81548194 ATCTTAGCTCCACTGCTTACTGG - Intronic
976475924 4:85482862-85482884 ATCCCAGATCTACCACATAGTGG - Intronic
977153790 4:93547706-93547728 ATCTCAGATCTACCACTTTCTGG - Intronic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
978629538 4:110728043-110728065 ATCCTGGCTCTAGCACTTACTGG + Intergenic
979463621 4:121010880-121010902 ACCCTGGATCTATTACTTACTGG + Intergenic
979733778 4:124056461-124056483 ATCCCAGGTCTACCACTTACTGG - Intergenic
980610891 4:135161880-135161902 TTCCTAGCCCTACTCCTTACAGG + Intergenic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
984476018 4:180236278-180236300 ATTCCAGGTCTACTACTTGCTGG - Intergenic
987101730 5:14597053-14597075 ATTCTGGCTCTTCTACTTACTGG + Intronic
990627112 5:57626477-57626499 ATTCTAGCTCTTCTACTAACTGG + Intergenic
990857661 5:60288252-60288274 ATCTTACATCAAATACTTACAGG + Intronic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
992493087 5:77264627-77264649 ATCCAACAACCACTACTTACTGG - Intronic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
994818620 5:104618672-104618694 ATCCTAGCTCTTCTGATTACTGG + Intergenic
994918299 5:106007598-106007620 CTCAATGATCTACTACTTACTGG - Intergenic
995315101 5:110760836-110760858 ATCCTGGCTCCATTACTTACTGG - Intronic
995625599 5:114072718-114072740 ATCCTGGATCTACCACTAACTGG + Intergenic
995696988 5:114890335-114890357 ATCCTTGATCTACATCTTAGAGG + Intergenic
997503010 5:134393095-134393117 ATCCCAGTTCTATGACTTACTGG - Intergenic
997639274 5:135437950-135437972 ATCCCAGCTCTACCACTTACTGG - Intergenic
997998413 5:138604934-138604956 ATCCTAGCTCTACCACTTGATGG - Intergenic
998183315 5:139960562-139960584 ATCCTAACTCTATTACTTACTGG + Intronic
998808130 5:145938547-145938569 TTCCTTGTTCTACTACTTTCTGG - Intronic
998889025 5:146726634-146726656 ATCTTAGCTCCACTACTAACTGG - Intronic
999345058 5:150810604-150810626 GTCCTGGATCTGCCACTTACTGG - Intergenic
999440418 5:151596299-151596321 ATCCTAGCTCTACCATTTAAAGG - Intergenic
999638974 5:153651899-153651921 ATCCCAGCTCTAGTATTTACTGG + Intronic
999803353 5:155058389-155058411 ATCCTGGCTCTACCACTTACAGG + Intergenic
999837989 5:155394982-155395004 ATCCTGGCTCTACCACCTACTGG - Intergenic
1001004852 5:168041197-168041219 ATCCCAGATTTCCCACTTACTGG + Intronic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1002060905 5:176625534-176625556 ATCCTAACTCCACTACTTCCTGG - Intronic
1003270521 6:4603628-4603650 AACCCAGATCTATTCCTTACAGG + Intergenic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004274003 6:14219961-14219983 ATCCTAGTGCTACCATTTACCGG - Intergenic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1004676847 6:17851015-17851037 ATCCCAGCTCTACCTCTTACTGG - Intronic
1004876717 6:19963004-19963026 ATTCTAGATCTACTAATTGTAGG - Intergenic
1005413402 6:25575113-25575135 ATCCTGAACCTGCTACTTACTGG - Intronic
1007146476 6:39638965-39638987 ACTCTAGATCAGCTACTTACAGG + Intronic
1007819466 6:44550337-44550359 ATCTGAGCTCTACCACTTACTGG - Intergenic
1008360367 6:50610228-50610250 ATCCTAGTACTACCACTCACTGG + Intergenic
1011435974 6:87337164-87337186 ATCCTGGATGTATTTCTTACAGG - Exonic
1011751066 6:90455168-90455190 AGCCTGGCTCTACCACTTACTGG + Intergenic
1012068501 6:94580397-94580419 ATCCCAGATCTTCTGCTTACTGG - Intergenic
1013138964 6:107311713-107311735 ATCTTAGATCTGCTACTTTATGG + Intronic
1013646652 6:112149227-112149249 ATCCTGAATCTGCTTCTTACTGG + Intronic
1015008971 6:128320388-128320410 ATCACAGATATACTACTTGCTGG + Intronic
1015498773 6:133908697-133908719 ATCCAAGATCTCCTATTTATAGG + Intergenic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1015973028 6:138761779-138761801 ATCCTAGCTGTACTACTGGCTGG + Intronic
1016658580 6:146548909-146548931 TTCATGTATCTACTACTTACAGG + Intronic
1016690253 6:146929849-146929871 ATTCTAGGTCTCCCACTTACTGG - Intergenic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1019790051 7:3005895-3005917 AACCTGGCTCTACCACTTACTGG + Intronic
1021270213 7:18575726-18575748 ATCCTAAAGCAATTACTTACTGG - Intronic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1022032598 7:26505913-26505935 ATGCTGGCTCTACCACTTACAGG + Intergenic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1023473996 7:40556631-40556653 ATCCCAGTTCTACCACTTAGTGG + Intronic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1026078674 7:67197694-67197716 ATCCCATTTCTACTCCTTACTGG - Intronic
1026698146 7:72614260-72614282 ATCCCATTTCTACTCCTTACTGG + Intronic
1028866962 7:95724850-95724872 ATTCTGGATCCACCACTTACTGG - Intergenic
1031857387 7:126938890-126938912 ATCCTAGTTCTCCCAATTACAGG + Intronic
1034201783 7:149287265-149287287 ATCCCAGCTCTACCACTCACTGG - Intronic
1036414650 8:8535755-8535777 ATCCCAGATCTGCCATTTACTGG - Intergenic
1037340610 8:17840588-17840610 ATCCTGGCTCTATTACTTACTGG - Intergenic
1037750103 8:21676065-21676087 ATCCCAGATCTGCCACTAACTGG + Intergenic
1038129190 8:24710256-24710278 ATCCTAGCCCTACTCCTTACAGG - Intergenic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1044604033 8:94033497-94033519 ATCCTAGCCCCACCACTTACTGG - Intergenic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1045166783 8:99615316-99615338 ATCCTGGCGCTACCACTTACTGG + Intronic
1045805074 8:106149746-106149768 ATCCCAGCTTTAATACTTACTGG - Intergenic
1046740271 8:117820275-117820297 ATCCCAGATCTACCACTTACTGG + Intronic
1047079039 8:121438848-121438870 ATCCCAAATCCACTACTTACTGG + Intergenic
1047196276 8:122724833-122724855 ATCCTGACTCTACTACTTCCTGG - Intergenic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047496370 8:125411961-125411983 ATCCTGGCTGCACTACTTACAGG - Intergenic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1048033668 8:130656533-130656555 ATCCTACATTCACTAGTTACAGG - Intergenic
1048126976 8:131646536-131646558 ATCTTGGTTCCACTACTTACTGG - Intergenic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048256633 8:132909850-132909872 ATCCCGGCTCTACTACCTACTGG + Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1051719584 9:20022453-20022475 ATCCTGCCTCTACTACTTGCTGG - Intergenic
1051803013 9:20958044-20958066 ATCCCACTTCCACTACTTACTGG + Intronic
1053609103 9:39692922-39692944 ATCCAGGATCTGCTACTCACTGG + Intergenic
1053866947 9:42449192-42449214 ATCCAGGATCTGCTACTCACTGG + Intergenic
1054089213 9:60778567-60778589 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054244422 9:62649476-62649498 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054558549 9:66684019-66684041 ATCCAGGATCTGCTACTCACTGG - Intergenic
1055959484 9:81806828-81806850 CTCCCACATCTTCTACTTACAGG - Intergenic
1057717715 9:97508135-97508157 ATCCAAGGTCTACTAGTTACTGG + Intronic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1057963484 9:99479496-99479518 ATCCCAGCTTCACTACTTACTGG + Intergenic
1058642060 9:107097159-107097181 ATCCTGGATCTGCTACCTTCTGG + Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059159599 9:112021484-112021506 ATCCTAGCTCTGCTAGGTACTGG + Intergenic
1059356955 9:113707349-113707371 ATCCCAGCTCTACCACTTACGGG - Intergenic
1059691660 9:116690702-116690724 ATCCTTGCTCTATTACTTATTGG + Intronic
1059722038 9:116969258-116969280 AACCTGGTTCTATTACTTACTGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1059936045 9:119311904-119311926 ACCCTAGCTCCACTCCTTACTGG + Intronic
1060618568 9:125042714-125042736 ATCATAGCTCTACAGCTTACTGG - Intronic
1060700075 9:125743432-125743454 ATTCAAGCTCTAGTACTTACTGG + Intergenic
1061048407 9:128179988-128180010 ATGCTGGCTCTACCACTTACAGG + Intronic
1061518168 9:131101711-131101733 ATCCCAGATCTGCCACTTCCTGG - Intronic
1186724503 X:12342927-12342949 ATCCCAGCTCTACCTCTTACTGG - Intronic
1188184552 X:27097904-27097926 ATCCAAGCTCTGCTACCTACTGG - Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1190472673 X:50798594-50798616 ATCACAGCTCTACCACTTACTGG + Intronic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1195806861 X:108783011-108783033 TTCCTTGATCTACTAATTATTGG + Intergenic
1196149259 X:112354250-112354272 ATCCAGGCTCTACTACATACTGG + Intergenic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196749460 X:119101836-119101858 ATCCTAGCTATACCACTTATTGG + Intronic
1197028861 X:121789387-121789409 ATCCTGGCTCCACTATTTACAGG + Intergenic
1197717740 X:129721629-129721651 ATCCCAGATCTCCCACTTTCTGG - Intergenic
1198208051 X:134487565-134487587 ATTCAAGCTCTACCACTTACTGG - Intronic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1198477966 X:137014157-137014179 ATCATGGCTCTACCACTTACTGG - Intergenic
1199664135 X:150083164-150083186 ATCCAAGCTCTACTGCTTCCTGG - Intergenic
1199855749 X:151757517-151757539 ATCCCAGATCTTTCACTTACTGG - Intergenic