ID: 919097598

View in Genome Browser
Species Human (GRCh38)
Location 1:193057183-193057205
Sequence GAGTGTTTCACCAGCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919097595_919097598 15 Left 919097595 1:193057145-193057167 CCATTTTCTTGTCCATCAAGCCT 0: 1
1: 0
2: 0
3: 25
4: 310
Right 919097598 1:193057183-193057205 GAGTGTTTCACCAGCCACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
919097597_919097598 -5 Left 919097597 1:193057165-193057187 CCTGCTCTTCACTTGTAAGAGTG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 919097598 1:193057183-193057205 GAGTGTTTCACCAGCCACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
919097596_919097598 3 Left 919097596 1:193057157-193057179 CCATCAAGCCTGCTCTTCACTTG 0: 1
1: 0
2: 3
3: 19
4: 235
Right 919097598 1:193057183-193057205 GAGTGTTTCACCAGCCACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
919097594_919097598 27 Left 919097594 1:193057133-193057155 CCAAATCTGAATCCATTTTCTTG 0: 1
1: 0
2: 3
3: 37
4: 346
Right 919097598 1:193057183-193057205 GAGTGTTTCACCAGCCACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919097598 Original CRISPR GAGTGTTTCACCAGCCACCC AGG Intronic
902104020 1:14018529-14018551 CAGTGCTTCATCAGCCATCCAGG - Intergenic
903682734 1:25107974-25107996 GAGGGTTGCACCAGGCATCCTGG + Intergenic
905187245 1:36205285-36205307 GAATTTCTCACCAGCCAGCCTGG - Intergenic
905511771 1:38527448-38527470 GAGAATTTAACCAGCCACCAGGG + Intergenic
907610848 1:55869286-55869308 CAGAGTGTCACCACCCACCCAGG - Intergenic
909697410 1:78483652-78483674 GAATCTTTCACCAGCAACCAAGG + Intronic
911842758 1:102704936-102704958 CAATGTTTCACCAGCCACCTAGG + Intergenic
913417144 1:118621333-118621355 GAGTTTTACTCCAGTCACCCAGG + Intergenic
914243565 1:145869499-145869521 CAGGGTCTCACCTGCCACCCAGG + Intronic
914751935 1:150540565-150540587 GAGTCTTGCTCCAGTCACCCAGG - Intergenic
915932016 1:160066721-160066743 GAGAGGTGCAGCAGCCACCCAGG + Intronic
916175585 1:162035490-162035512 GACTGTTTCTCCTGCCACCTGGG - Intergenic
918423756 1:184387681-184387703 GTGTCTAACACCAGCCACCCAGG - Intronic
918481987 1:184988508-184988530 TAGTGTTTCACCAGACAGCTGGG - Intergenic
919097598 1:193057183-193057205 GAGTGTTTCACCAGCCACCCAGG + Intronic
919744595 1:201000502-201000524 GGGTGCTTCTCCAGCCGCCCCGG - Exonic
919901658 1:202048306-202048328 CAGGGTTTCACCTGTCACCCAGG + Intergenic
922548217 1:226474295-226474317 CAGTGCTTCACCAGCCATCCAGG + Intergenic
922571927 1:226639514-226639536 GAGGGTCTCTCCAGCCAGCCAGG - Intronic
923456427 1:234169290-234169312 GAGTGTCTCACCAGCTGCCTGGG + Intronic
923802087 1:237220098-237220120 CAATGCTTCACCAGCCATCCAGG - Intronic
924153356 1:241151164-241151186 CAATGTTTCACCAGCCATCTAGG + Intronic
924708947 1:246518834-246518856 GAACGTCTCTCCAGCCACCCTGG + Intergenic
1063717584 10:8543803-8543825 CAGTGTTTCACAAGGCTCCCTGG + Intergenic
1064298946 10:14104644-14104666 GAGAATTTCCCCAGCCACTCTGG + Intronic
1067032118 10:42885021-42885043 GAGTGTCTCACCAACAAGCCTGG - Intergenic
1070544702 10:77443068-77443090 GTGTGTGTACCCAGCCACCCTGG - Intronic
1074359882 10:112817184-112817206 GAGTATTACACCAGCCCCTCTGG + Exonic
1075406380 10:122198538-122198560 GAGTGTTTCATCTCCCACTCAGG + Intronic
1076106538 10:127827827-127827849 GATTTTTTCAGCTGCCACCCAGG - Intergenic
1076818004 10:132924093-132924115 CTGTGATTCTCCAGCCACCCTGG + Intronic
1076976591 11:176581-176603 GAATGTTTGGCCAGGCACCCAGG - Intronic
1077430246 11:2512678-2512700 GAGTGTGGCCCCAGACACCCAGG - Intronic
1077782485 11:5346804-5346826 GAGTATTTCACCATACTCCCAGG + Intronic
1078343211 11:10516709-10516731 GCCTGTTTCACCAGCCAGACTGG + Intronic
1079330171 11:19526676-19526698 GAGAGCTTCCCCAGCCATCCTGG - Intronic
1080669558 11:34363547-34363569 GAGTCTTCTACCAGCCACTCTGG - Intergenic
1084375331 11:68773088-68773110 GGGTGTTTCACCACGCACGCGGG - Intronic
1084697719 11:70765712-70765734 TAATGTTACACCAGCCACCCTGG - Intronic
1087997627 11:104830145-104830167 GAGTGTTTTCCCCTCCACCCCGG - Intergenic
1088687701 11:112298612-112298634 CAATGCTTCACCAGCCACCTCGG + Intergenic
1089152415 11:116374277-116374299 AAATGTTTTACCAGCCACCTGGG + Intergenic
1090224391 11:125061382-125061404 GAGTGTTCCCACTGCCACCCTGG + Intergenic
1092041975 12:5393238-5393260 AAGTGTTGCACCAGCCAGCCAGG + Intergenic
1094611940 12:32002984-32003006 GCCTTTTTCCCCAGCCACCCTGG + Intergenic
1096151377 12:49315276-49315298 CAATGTTTCACCAGCCATCAAGG + Intergenic
1097198292 12:57256842-57256864 CAGAGTTTCACTCGCCACCCAGG + Intronic
1099214248 12:79834951-79834973 CAGTGCTTCACCAGCCATCTAGG - Intronic
1100091178 12:90973423-90973445 CACTGTTTCACCAGCTACCATGG - Intronic
1101208565 12:102513490-102513512 GAGGGTTTCCCCAGACACCTGGG + Intergenic
1105289550 13:19042184-19042206 GAGTGTTTCCCCAGCTATCTGGG - Intergenic
1106527841 13:30558867-30558889 GAGTTTTTCACAAGCCTCCAAGG + Intronic
1107216133 13:37920852-37920874 CAGGGTTTCACCAGCCAGGCTGG + Intergenic
1109080315 13:57891477-57891499 GAATGCTTCACCAGCCACTTAGG - Intergenic
1113218818 13:108074443-108074465 CAATGCTTCACCAGCCACCTCGG + Intergenic
1114204068 14:20551695-20551717 CAGTGCTTCACCAGCCATCTAGG - Intergenic
1114302811 14:21393605-21393627 GAGTGTTCCACCAGTCAAACTGG - Exonic
1115727209 14:36230078-36230100 AAGTGTTTCAGCAGCCCTCCAGG - Intergenic
1118917028 14:70116165-70116187 TATTATTTCCCCAGCCACCCCGG - Intronic
1119342908 14:73895767-73895789 GAGGGTTTCACCAGCCAGGCTGG - Intronic
1120488628 14:85148009-85148031 GAGTGTTTCACCAGCTATCTGGG - Intergenic
1124558289 15:30747687-30747709 GAAGGTCTCATCAGCCACCCCGG - Intronic
1126794523 15:52249370-52249392 GAATGTTGAAGCAGCCACCCTGG - Intronic
1126815498 15:52449521-52449543 CAGTGTTTCACCACTGACCCTGG + Intronic
1128758625 15:70199693-70199715 GAGGGTGTCATCAGCCACTCAGG + Intergenic
1136181516 16:28555695-28555717 AAGTGTTTCACCAGCTATCTGGG + Intronic
1136660076 16:31749798-31749820 GAATCTTTCACCAGCAACCAAGG - Intronic
1137497419 16:48981529-48981551 GAGTGTTTCTCCAGCCACATGGG + Intergenic
1141040098 16:80665778-80665800 GAGTTTTTCACCTGCCATCTTGG - Intronic
1141593453 16:85083512-85083534 GTGTGTTTAACCAGCCTTCCAGG + Intronic
1142443823 16:90121593-90121615 GAATGTTTGGCCAGGCACCCGGG + Intergenic
1142463603 17:113622-113644 GAATGTTTGGCCAGGCACCCGGG - Intergenic
1142532069 17:586496-586518 GATGGTTTCACCATTCACCCTGG + Intronic
1145953745 17:28840457-28840479 GAGTGTTTCTTCAGCCTCTCAGG + Intronic
1147536230 17:41324704-41324726 GAATGTTTCCCCAGCCACCCTGG - Intergenic
1148350065 17:46934910-46934932 GATTCTTTCACCAGCCCCTCCGG + Intronic
1149497055 17:57125642-57125664 TTGTCTTTCACCAGCCTCCCTGG + Intergenic
1149603844 17:57911116-57911138 GTGTGTTTAACCAGCCCTCCAGG - Intronic
1152319827 17:79602489-79602511 GTGTGGTTCACCGGCCATCCTGG - Intergenic
1152765322 17:82134176-82134198 GCGTGGTGCAACAGCCACCCTGG + Intronic
1153449412 18:5210054-5210076 CAATGTTTCACCAGCTATCCAGG + Intergenic
1155083250 18:22431089-22431111 GTGTGTTGCATAAGCCACCCAGG - Intergenic
1157103875 18:44755277-44755299 CAATGTTTCACCAGCCATCTGGG - Intronic
1157683580 18:49625780-49625802 GTGTGTTTCACAAGCTCCCCTGG - Intergenic
1159885211 18:73897171-73897193 GAGTAGTTTACCAGCCACACGGG + Intergenic
1161535205 19:4814957-4814979 GAGTGCTGCACCTGCTACCCAGG + Intergenic
1161997581 19:7723236-7723258 CAATGCTTCACCAGCCATCCAGG - Intergenic
1163377054 19:16939554-16939576 GAGTGTTTAACCAGCTACCTGGG - Intronic
1166356749 19:42231745-42231767 TAGAGTTTCACTCGCCACCCAGG - Intronic
1167034582 19:46987239-46987261 GAGAGTCTCACCTGTCACCCAGG + Intronic
1168324514 19:55531092-55531114 GAGTGCCTCACCGGCCTCCCAGG - Intronic
926679414 2:15652501-15652523 GAGAACTTCACCAGCCAGCCAGG - Intergenic
930046929 2:47180716-47180738 GAGTGACCCACCAACCACCCTGG - Intergenic
931465697 2:62484961-62484983 CAGGGTTTCACCTGTCACCCAGG + Intergenic
932982029 2:76681005-76681027 AATTGTTTCACCAGCCTCCCTGG - Intergenic
935949345 2:108314643-108314665 GAGTGTTTCACCATCTATCTTGG - Intergenic
936008639 2:108910829-108910851 GCCTGTTGCACCAGCCACCCGGG - Exonic
938251908 2:129821959-129821981 GTGTCTTTCGCCTGCCACCCTGG - Intergenic
939380985 2:141435874-141435896 CAGTGTTTCTCCTCCCACCCAGG - Intronic
941581737 2:167305100-167305122 AAATGTTTTACCAGCCACCTAGG + Intergenic
941644681 2:168027225-168027247 GTGTGTATCTCCAGCCACCATGG + Intronic
942497143 2:176551735-176551757 TAATGTTTTACCAGCTACCCAGG - Intergenic
943753654 2:191536275-191536297 GAGTGTTTTCCCTGGCACCCTGG - Intergenic
946387404 2:219393005-219393027 GGATGTTTCTCCAGCCACACAGG - Intronic
947028426 2:225764879-225764901 CAGTGTTTTACCAGCTACCTGGG - Intergenic
947073116 2:226313433-226313455 GTGTGTATCACCAGCCTGCCAGG + Intergenic
1175665453 20:60854717-60854739 CAATGCTTCACCAGCCACCTAGG + Intergenic
1175672408 20:60916713-60916735 GATTGTTTCAACAAACACCCAGG + Intergenic
1175687616 20:61043135-61043157 GAGGTTTTCACCAATCACCCCGG + Intergenic
1175987981 20:62773630-62773652 GCGTTTTTTCCCAGCCACCCTGG - Intergenic
1176913092 21:14591895-14591917 GAGTCTTTCAGAAGCCACACAGG + Intergenic
1177511474 21:22092363-22092385 GAATCTTTCACCAGCAACCAAGG - Intergenic
1178618732 21:34156120-34156142 CAGTGTTTCATCAGCCTCCCTGG - Intergenic
1179571171 21:42279689-42279711 GCGACTTTCACCAGCTACCCCGG - Intronic
1180785424 22:18544472-18544494 CAGTGCTTCCCCACCCACCCTGG + Intergenic
1181129007 22:20718513-20718535 CAGTGCTTCCCCACCCACCCTGG + Intronic
1181242327 22:21483825-21483847 CAGTGCTTCCCCACCCACCCTGG + Intergenic
1183860162 22:40664162-40664184 CAATGTTTCACCAGCCAACTAGG - Intergenic
1184470895 22:44695622-44695644 GAGTTTTGCTCCTGCCACCCAGG + Intronic
1184859725 22:47166313-47166335 GAATGTGTCACCAGCCACATAGG + Intronic
949530170 3:4947720-4947742 GTATGTTTAACAAGCCACCCAGG + Intergenic
952872290 3:37911734-37911756 GAGGGTTACACCTGCCACCCAGG - Intronic
953297926 3:41739737-41739759 GACTCCTTCTCCAGCCACCCAGG + Intronic
958503840 3:94947205-94947227 GAATCTTTCACCAGCAACCAAGG - Intergenic
960413283 3:117354290-117354312 GAGTGTTTCACCTACCTCACTGG + Intergenic
964063951 3:152558839-152558861 AATTGTTTCACCAGCCACGCGGG + Intergenic
965430567 3:168582633-168582655 CAATGTTTCACCAGCTACCTAGG - Intergenic
965603368 3:170476210-170476232 GAATGTTTCAGAAGCAACCCAGG + Intronic
967296832 3:187973605-187973627 GGGTGTTTCACCAGCCAGGCTGG - Intergenic
968364119 3:198172641-198172663 GAATGTTTGGCCAGGCACCCGGG + Intergenic
969201311 4:5608458-5608480 TAATGTTTTACCAGCCACCTGGG - Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
972460294 4:39295671-39295693 GAGTGCTTCCCCAGCCAGCTTGG + Exonic
973942325 4:55923642-55923664 TAATGTTTCACCAGCTATCCAGG + Intergenic
975643022 4:76519136-76519158 TAGTGTTTCACTGGCCACCCAGG - Intronic
975705566 4:77109125-77109147 GAGTGTGACTCCAGTCACCCTGG + Intergenic
977089471 4:92652303-92652325 TAATGTTTTACCAGCCACCTGGG + Intronic
979763360 4:124435022-124435044 AAGTTTGTCACCAGCCACTCAGG + Intergenic
980253481 4:130348547-130348569 GAGTTTTTCTCCAGCCCACCGGG + Intergenic
980393039 4:132170223-132170245 GAATCCTTCACCAGCAACCCAGG - Intergenic
980631129 4:135435400-135435422 AAGACTTTCACCAGTCACCCTGG - Intergenic
983019722 4:162660446-162660468 CAGGGTTTCACCTGTCACCCAGG + Intergenic
984615178 4:181889017-181889039 TACTGTTTCACCAGCTACCCGGG + Intergenic
987335364 5:16893930-16893952 GAGTGTGTGACAAGCCAGCCAGG + Intronic
988034967 5:25815631-25815653 AAATGTTTCACCAGCCATCTGGG + Intergenic
989540799 5:42616430-42616452 AATTGTTTCACCATCCACTCAGG - Intronic
999606522 5:153322951-153322973 GGTTGTTTCACCAGCCCTCCTGG - Intergenic
1001173703 5:169445422-169445444 GCCTCTTTCCCCAGCCACCCCGG + Intergenic
1001387034 5:171348432-171348454 CAGTGTTTCCCCCGTCACCCAGG + Intergenic
1002148267 5:177204183-177204205 GATTGCTTTTCCAGCCACCCAGG - Exonic
1003218158 6:4134368-4134390 GTATGTTTAACCAGCCAGCCAGG + Intronic
1003236449 6:4299617-4299639 CAATGCTTCACCAGCCATCCAGG - Intergenic
1006314053 6:33279926-33279948 GAGGGGTTCAGCAGCCTCCCTGG - Intronic
1007983457 6:46183362-46183384 GAATGTTTCAGCAGCTACCTGGG + Intergenic
1011683943 6:89809189-89809211 CAGTGTCTCACCTGTCACCCAGG - Intronic
1013038686 6:106412067-106412089 CAGTGCTTCACCAGCCATCTAGG + Intergenic
1013137572 6:107297406-107297428 GAGTCTTGCTCCTGCCACCCAGG + Intronic
1015713945 6:136171445-136171467 GAATGTGTCACCAGCTACCCTGG + Intronic
1015932754 6:138378133-138378155 GAGTGGTTAACCAGCGAGCCCGG + Exonic
1016812804 6:148277446-148277468 GAGAGTTTGACCAGTGACCCTGG - Intronic
1016976304 6:149812307-149812329 GAGAGTTTCACTCGTCACCCAGG - Intergenic
1017466877 6:154702749-154702771 GAGAGTCTCACTCGCCACCCAGG + Intergenic
1017760409 6:157563636-157563658 GAGTGTGTCCCCAGCCAGCAGGG + Intronic
1019251700 7:17025-17047 GAATGTTTGGCCAGGCACCCGGG - Intergenic
1024865052 7:53896032-53896054 CAATGCTTCACCAGCCATCCAGG - Intergenic
1031489863 7:122373289-122373311 GCATGTTTAACCAGCCACCATGG - Intronic
1031999959 7:128258413-128258435 CAGAGTCTCACCTGCCACCCAGG - Intergenic
1033202153 7:139382596-139382618 GAGTGTGAGACCAGCCAGCCAGG - Intronic
1033391166 7:140928845-140928867 GAGAGTCCCACCAGCCAGCCAGG + Intergenic
1035351015 7:158246518-158246540 GAGCGTTTCACAAGTCACCGTGG + Intronic
1037480821 8:19303582-19303604 GATGGTTTCACCAGCCAACAAGG + Intergenic
1037817064 8:22117937-22117959 CAGTGTTTCCCAGGCCACCCAGG + Intronic
1038419520 8:27423486-27423508 GCGTTTTTGACCAGCCCCCCAGG + Intronic
1038660506 8:29492790-29492812 GCTTGTTCCACCAGCCTCCCAGG - Intergenic
1039414074 8:37378796-37378818 CAGTCCTTCACCAGCCATCCAGG + Intergenic
1039791413 8:40878826-40878848 GAGTGTTTTTCCAGCATCCCAGG + Intronic
1042765571 8:72317746-72317768 AAGTGGTTCTGCAGCCACCCTGG + Intergenic
1043207362 8:77462974-77462996 TAATGTTTTACCAGCCACCTTGG - Intergenic
1043687432 8:83105335-83105357 GAGTGTTTCACCAGTAATTCTGG - Intergenic
1045060166 8:98404000-98404022 GGGGGTTTGACCTGCCACCCAGG - Intronic
1046898672 8:119500470-119500492 AAGTGTTTCACCAGCTAGGCTGG - Intergenic
1048037788 8:130693648-130693670 GAATGTTTTGCCATCCACCCAGG - Intergenic
1048065191 8:130960539-130960561 GAGGGTTTCTGCAGCCACCTAGG + Intronic
1053426170 9:38011523-38011545 GAGTGACTCACTAGTCACCCAGG - Intronic
1055096997 9:72423899-72423921 CAGTGCTTCACCCTCCACCCAGG - Intergenic
1055156338 9:73067105-73067127 TAGTCTTTCTCTAGCCACCCTGG + Intronic
1056778627 9:89532856-89532878 AACTGCTTCACCAGCCATCCAGG - Intergenic
1057663955 9:97028731-97028753 GCCTCTTTCCCCAGCCACCCTGG + Intergenic
1061721609 9:132555363-132555385 GAGTGTGTCCCCAGCTTCCCTGG + Intronic
1061817920 9:133207405-133207427 GAATGTTTCAGCGGTCACCCAGG + Intronic
1062748812 9:138236588-138236610 GAATGTTTGGCCAGGCACCCGGG + Intergenic
1185573162 X:1149973-1149995 GAGTCTTGCTCCTGCCACCCAGG - Intergenic
1186102951 X:6176123-6176145 GAATTTCTCACCAGCCAGCCAGG + Intronic
1186688091 X:11946601-11946623 TAATGTTTCACCAGCTACCTAGG - Intergenic
1189134029 X:38531257-38531279 GAGCCATTTACCAGCCACCCTGG - Intronic
1190581982 X:51898457-51898479 AACTGTTTCCCCATCCACCCAGG - Intronic
1193565077 X:83065958-83065980 CAGTGCTTCACCAGCCATCTGGG + Intergenic
1194433162 X:93836839-93836861 CAGTGCTTCACCGGCCATCCAGG + Intergenic
1194796885 X:98223094-98223116 AAGTGTTACATCACCCACCCCGG + Intergenic
1198478434 X:137018037-137018059 GAGTCTTTCCACAGCCACCATGG - Intergenic
1200474623 Y:3629015-3629037 GAGAGTTTCACCAGTGACCTGGG - Intergenic
1201369253 Y:13243207-13243229 GAGTCTTGCTCCAGTCACCCAGG - Intergenic
1201389235 Y:13479471-13479493 GAGAGTATCGCCAGCCAACCAGG + Intronic