ID: 919102214

View in Genome Browser
Species Human (GRCh38)
Location 1:193108744-193108766
Sequence CTGAATATATAAATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919102214_919102216 -2 Left 919102214 1:193108744-193108766 CCATTATCCATTTATATATTCAG No data
Right 919102216 1:193108765-193108787 AGTCCCTCACCATTAAATAATGG No data
919102214_919102217 -1 Left 919102214 1:193108744-193108766 CCATTATCCATTTATATATTCAG No data
Right 919102217 1:193108766-193108788 GTCCCTCACCATTAAATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919102214 Original CRISPR CTGAATATATAAATGGATAA TGG (reversed) Intergenic
No off target data available for this crispr