ID: 919104064

View in Genome Browser
Species Human (GRCh38)
Location 1:193127439-193127461
Sequence TGGGACTACTTGGGAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919104059_919104064 30 Left 919104059 1:193127386-193127408 CCTGAGTAAGAAATATATATTTA 0: 1
1: 0
2: 4
3: 73
4: 842
Right 919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG 0: 1
1: 0
2: 1
3: 31
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919104064 Original CRISPR TGGGACTACTTGGGAAAATA AGG Intronic
903922069 1:26806822-26806844 TGGGGCTACTTGGGAGGATAAGG - Intergenic
906167550 1:43698201-43698223 AGGTACTTCTAGGGAAAATAGGG - Intronic
907362434 1:53929414-53929436 TGGGGCTACTTGCAAAATTATGG - Intronic
909769712 1:79405876-79405898 TGGAAGTACTGTGGAAAATAGGG - Intergenic
909924826 1:81426878-81426900 TGAGACTACTTTGAAAAGTATGG + Intronic
911208982 1:95119814-95119836 TGGGACTAATTTGGAAAGAAGGG - Intronic
913268066 1:117064631-117064653 TGGGACTACTTGGGAGGCTGAGG - Intronic
915915046 1:159935903-159935925 TGAGACTAATTGGGGAAACAGGG - Intronic
917509509 1:175658572-175658594 TGGGACCACTTGAGAATAGAAGG - Intronic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922230667 1:223682811-223682833 TGGGAGTAGTGGGGAAGATATGG - Intergenic
923450469 1:234112465-234112487 TGGGATTACTTTTGGAAATACGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063511469 10:6648440-6648462 GTGGACTATTTGGGAAAAGAAGG - Intergenic
1065312151 10:24426856-24426878 TGGGACGCTTCGGGAAAATAAGG + Intronic
1066488502 10:35872093-35872115 TGGGAGCACTTGGTAAAATGAGG + Intergenic
1068055026 10:52002060-52002082 TGGGAATACTTGTGAAGAGATGG - Intronic
1068075936 10:52253997-52254019 TGGCAAGAATTGGGAAAATAAGG - Intronic
1068652294 10:59535798-59535820 TGGGATAAGTTGGGGAAATAGGG + Intergenic
1070261014 10:74856051-74856073 TGGGGCCATTTGGGGAAATATGG - Intronic
1070481471 10:76887165-76887187 GGGGACTACAGGGGAAAACAGGG + Exonic
1070640575 10:78166026-78166048 TGAGCCTACTTGGGACAAAAAGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077920572 11:6639139-6639161 TAGGACTACTTGGGAAGCAAAGG - Intronic
1078399971 11:11017598-11017620 TGGGACTATTTAGAAAGATATGG + Intergenic
1079430393 11:20384138-20384160 TGGAACTACCTGGAAATATACGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085798106 11:79562374-79562396 TGGGACAACTTGGGTAAACTGGG + Intergenic
1087232957 11:95686565-95686587 TGAGGCTACTTTGGAAAATGGGG + Intergenic
1087425041 11:97974802-97974824 TAGGACTTCTTGGCAAAATGAGG + Intergenic
1088553048 11:111034031-111034053 GGGGATTACTTAGGAAAAGATGG + Intergenic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095670260 12:44850964-44850986 TGGGACTAATTAGGAAGATGTGG + Intronic
1096006359 12:48175830-48175852 TGGCATTGCTTGGGGAAATAGGG + Intronic
1096861302 12:54530420-54530442 TGGGACTACTAGAGAAAAGAAGG + Intronic
1099353495 12:81604253-81604275 TGGAAATGGTTGGGAAAATATGG + Intronic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1104436506 12:128761182-128761204 TGAGACTTCTTGGGAGAAGATGG + Intergenic
1106993829 13:35457591-35457613 AGGGACTACATGTCAAAATATGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107574279 13:41700213-41700235 TGGGACTACCCTGGAAAATCTGG + Intronic
1109378566 13:61526886-61526908 TGTGACTACTTGGGTTTATATGG + Intergenic
1109585691 13:64399901-64399923 GGGGAGTACTTGGGAAGAAATGG - Intergenic
1111241970 13:85485509-85485531 TGTGACTATATAGGAAAATAAGG + Intergenic
1111691118 13:91564367-91564389 TGGGACAACTTGGCAAGATCTGG + Intronic
1111714665 13:91865252-91865274 TGGGATTACTTTGGCAAACATGG + Intronic
1112319466 13:98394041-98394063 TGGGTCCACTTGGGAAGAGATGG + Intronic
1112476261 13:99733609-99733631 TTGGACTAATTTGGAAAATATGG + Intronic
1113114576 13:106861652-106861674 TGGGGCAACTTGGGAGAAGATGG + Intergenic
1116279104 14:42879187-42879209 TTGGACTACTTGGATAAACAGGG - Intergenic
1117901617 14:60539500-60539522 TGGGCCTACTTGAGAATAAAGGG - Intergenic
1118473389 14:66094901-66094923 TTGGGCTACTTGGGAGACTAAGG + Intergenic
1118923675 14:70172404-70172426 TGGGACAGCTTAGTAAAATAGGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121358549 14:93234636-93234658 TGGGACAACTTGAGAAAAGAGGG - Intergenic
1123736488 15:23189619-23189641 TGGGATTACTTTGGCAAATATGG + Intergenic
1124287195 15:28412589-28412611 TGGGATTACTTTGGCAAATATGG + Intergenic
1124295508 15:28499043-28499065 TGGGATTACTTTGGCAAATATGG - Intergenic
1124552512 15:30694759-30694781 TGGGAATACTTGGGAGGACAAGG + Intronic
1124952266 15:34334780-34334802 TGGGACTACAGGGGTAAAAATGG - Intronic
1125028273 15:35052123-35052145 TGGAAATACTTGGGAATATTTGG + Intergenic
1125497203 15:40207952-40207974 TGGGACTACTTGGGAGGCTGAGG - Intronic
1127113697 15:55702260-55702282 TAGTTCTACTTGGGAAAATCAGG - Intronic
1127361031 15:58245388-58245410 TGGGAGGTGTTGGGAAAATAAGG - Intronic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1137839542 16:51627291-51627313 TGTAACTACTGGGGAAATTAAGG - Intergenic
1137896504 16:52218150-52218172 TGGAACTGCTTGGAAAAGTAGGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1140239424 16:73187972-73187994 AGCTACTACTTGGGAAACTAAGG - Intergenic
1140980714 16:80106209-80106231 TGGGAATATAAGGGAAAATAAGG + Intergenic
1145065841 17:19760606-19760628 TAGGTCTACATGGAAAAATAAGG - Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1148810527 17:50287769-50287791 TGGGACTACTTGGGAGGCTGAGG + Intergenic
1149422328 17:56522487-56522509 AGGGACTACCTGGGAAAACTGGG + Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1152276179 17:79358923-79358945 TGGGGGCACTTGGGAAAAGAGGG - Intronic
1152979601 18:263878-263900 TGGGACTTCTTGGCAAAGTTGGG + Intronic
1153272879 18:3340847-3340869 TTGGACTCCATGGGAAAGTAGGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1157264817 18:46209400-46209422 TGAGGCTACTTGTGAAAATCTGG - Intronic
1159306613 18:66651656-66651678 ATGGACTACATGGGAAAACATGG - Intergenic
1159663442 18:71127953-71127975 TGGGACTACTTAGGTGAAAATGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168552680 19:57310824-57310846 TGGGACTGATTGAGAAAAGAAGG + Intergenic
1168617435 19:57850017-57850039 TCGGACTACTTGGGGAAGCACGG - Exonic
1168625726 19:57916411-57916433 TCGGACTACTTGGGGAAGCACGG + Exonic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
935517382 2:104057730-104057752 TGAGACTCTTTGGGAAATTAGGG + Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
937438466 2:121897883-121897905 TGGGACTGTTTTGGGAAATAGGG - Intergenic
939352864 2:141062838-141062860 TGGGAATATTTGGGAGAATTTGG - Intronic
939669007 2:144986695-144986717 TGAGACTCCTTGTGAAATTAAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942746267 2:179236875-179236897 TAAAACTACTTGGTAAAATATGG - Intronic
943585404 2:189733399-189733421 TGGGACAACTCAGAAAAATATGG - Intronic
943726474 2:191256545-191256567 AGGGACCCCTTTGGAAAATATGG + Intronic
943729782 2:191290101-191290123 TGGCACTAATTGGGAACGTAGGG - Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
944905176 2:204255133-204255155 TGGGACTTCTGGGGAGTATAAGG + Intergenic
945744068 2:213699194-213699216 TGGGAATAATGGGGAAAATGGGG - Intronic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
1181964971 22:26650099-26650121 TGTGACTACATTGGAAGATAGGG + Intergenic
1183011656 22:34951722-34951744 AATGACTACTTTGGAAAATAAGG + Intergenic
949390099 3:3552068-3552090 TGGGAGTATGTGGAAAAATAGGG + Intergenic
951010301 3:17669584-17669606 TAGGGCTCCTTGGTAAAATAAGG + Intronic
953675378 3:44997367-44997389 TGGGATTAGTTGGGAAAAGATGG + Intronic
956004045 3:64760342-64760364 TGGAACTACTGGGAAAAATTAGG - Intergenic
956591954 3:70924542-70924564 TGGGCATACTTGGGAGAAAATGG - Intergenic
957333222 3:78792985-78793007 TGGGACTACTTGGGACCACTGGG - Intronic
958680443 3:97324090-97324112 AGGGACAGGTTGGGAAAATAAGG - Intronic
960209092 3:114937981-114938003 TGGGACTACTTGGGAGGCTGAGG + Intronic
960594436 3:119395424-119395446 TGGGACAGCTGGGGAAAACATGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963342594 3:144055033-144055055 TTTGCCTAATTGGGAAAATAAGG + Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
966135343 3:176691895-176691917 TGGGACTTCTGGGGAAACTGAGG - Intergenic
966895082 3:184438908-184438930 TAGGACTACTTGGAAGAATAAGG - Intronic
969954739 4:10877340-10877362 TGGGATTACTTGGGATCATGTGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972376315 4:38475125-38475147 TGGAGCCACTTGGGAAGATAAGG + Intergenic
974333513 4:60510011-60510033 TGGCAATACTTTGGAAAATCTGG + Intergenic
974340260 4:60605199-60605221 TGAGATTAATTGGTAAAATATGG - Intergenic
977278751 4:95011901-95011923 CTGAACTACTTGGGAAACTAGGG + Intronic
977381508 4:96279945-96279967 TTGGACTACTTGGAATAATAAGG - Intergenic
979104895 4:116672153-116672175 TGATACTACTTGGGAAAAGTTGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981628880 4:146794537-146794559 TGAGAAAACTTGGGAAAATTTGG - Intronic
982494873 4:156077971-156077993 TGGTGCTACTTGGGAAACTGAGG - Intergenic
983256544 4:165406746-165406768 TGGGAGGAATTGGGAAAATGAGG - Intronic
984273779 4:177582283-177582305 TGGGACTACTTTGAAAGAGATGG - Intergenic
988594138 5:32575529-32575551 TGTGACTACATTTGAAAATAGGG - Intronic
993427345 5:87784150-87784172 TGGAACAAATTAGGAAAATAAGG + Intergenic
994335158 5:98556218-98556240 TTGGACTTCTTGGGGACATACGG + Intergenic
995470842 5:112500655-112500677 TATGACCACTTGGGAAAATAAGG - Intergenic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
998448465 5:142216444-142216466 TTGGACTGCTGGGGAAATTATGG + Intergenic
999530228 5:152455090-152455112 TGGGTTAACTTGGGAAAATGAGG - Intergenic
999648473 5:153742536-153742558 TGGGACCTCTGGGGAGAATATGG + Intronic
1001253991 5:170169928-170169950 TGGGAATACGTGGAAGAATAAGG - Intergenic
1003745641 6:8998648-8998670 TGGGAATAATTGGCATAATAGGG + Intergenic
1003757382 6:9136977-9136999 TAAGAATACTTGGGAAAATGAGG + Intergenic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1008652590 6:53578073-53578095 TGCTACTACTGGGGAGAATAGGG + Intronic
1009330312 6:62410840-62410862 TGGGACTACTTGGGAGTCTGAGG - Intergenic
1009518155 6:64646427-64646449 TGAGAATATTTGGGAAAAGAAGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010653623 6:78484777-78484799 TGTGACCACTTGGAAAAAAATGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1011491250 6:87895819-87895841 TGCAACTACTTTGTAAAATAAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1018349406 6:162941221-162941243 TGGGACTACTGGAGAGAAGAAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022604521 7:31797019-31797041 TCAAACTACTTGAGAAAATAAGG + Intronic
1024088060 7:45913255-45913277 GGGGACTATTGGAGAAAATAAGG - Intronic
1024962938 7:54996543-54996565 TGGGACTACTGAAGAAAATGAGG - Intergenic
1025113185 7:56236378-56236400 TGGGACTACTTGGAAGGATGAGG + Intergenic
1026469376 7:70681829-70681851 TGGGACTAAGTTGGAACATAGGG - Intronic
1026554619 7:71395517-71395539 TGGGGCTATTAGGGATAATAGGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030350909 7:108485252-108485274 TGCTACTACTTGGGCAGATAGGG + Intronic
1031554527 7:123156163-123156185 TGGGATTACTGGGGATAATGGGG + Intronic
1032069884 7:128797894-128797916 AGGAACTACCTGGGAAAATAGGG + Intronic
1032906422 7:136372719-136372741 TGGGACTATCTGGGAAAACAGGG - Intergenic
1038903222 8:31867578-31867600 TTGTACTTTTTGGGAAAATAAGG + Intronic
1038932399 8:32208820-32208842 TATGACTACTTGGAAGAATATGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039672495 8:39617825-39617847 TGGGCCTACTTGAGAATGTAGGG + Intronic
1045223496 8:100221848-100221870 TGGGACCACATGGGAAGGTAAGG - Intronic
1045660619 8:104433792-104433814 CGTGACTACTTGGGAAGAGAGGG + Intronic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1048404408 8:134105293-134105315 TGTGACTACAAGGGAATATATGG - Intergenic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1051310715 9:15768054-15768076 TGGGACTGCTCGGGACAACAAGG - Intronic
1057014439 9:91638883-91638905 TGGGACTATATTTGAAAATAGGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057816298 9:98298253-98298275 TGGGTCTACTTGTGCAGATATGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060038931 9:120283168-120283190 TGGGACTCATTGGAAAAATTTGG - Intergenic
1190130847 X:47747661-47747683 TGAGAATACTAGGGAAAATGAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192325083 X:70124896-70124918 TGAGATTACTTGGGGAAACAGGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1196575959 X:117319477-117319499 GGGGAACACTTGGGAAGATAGGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198492944 X:137161790-137161812 TGAGAATCCTAGGGAAAATATGG + Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1202115929 Y:21468718-21468740 TGCGACTATTTGGGGAAAAACGG + Intergenic