ID: 919106325

View in Genome Browser
Species Human (GRCh38)
Location 1:193155910-193155932
Sequence TATTCCCTAGGTGTTAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919106325_919106330 11 Left 919106325 1:193155910-193155932 CCTACCCTAACACCTAGGGAATA 0: 1
1: 0
2: 0
3: 13
4: 185
Right 919106330 1:193155944-193155966 GACTAGTGTTTCATAGAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919106325 Original CRISPR TATTCCCTAGGTGTTAGGGT AGG (reversed) Intronic
900822100 1:4897655-4897677 TAATCCCCAGGTGTTAAGGGAGG + Intergenic
901296587 1:8165683-8165705 TAATCCCCAGGTGTCAGGGGAGG + Intergenic
909201844 1:72699540-72699562 TATTCCCTGGCTGTTAGGGCAGG + Intergenic
910466224 1:87503099-87503121 TAATCCCTATGTGTCAGGGGAGG - Intergenic
910700175 1:90064866-90064888 TATACTCTAAGTTTTAGGGTAGG + Intergenic
911018304 1:93358677-93358699 TATTCCCTCAGTTTTAGGGTTGG + Intronic
911545363 1:99209864-99209886 GATTCCCAATGTGATAGGGTTGG + Intergenic
911610161 1:99951584-99951606 TAATCCCTATGTGTTGGGGGAGG - Intergenic
916841998 1:168610123-168610145 TATTTACTAGGTGCTGGGGTGGG - Intergenic
918858323 1:189788251-189788273 TAATCCCCACTTGTTAGGGTAGG + Intergenic
919106325 1:193155910-193155932 TATTCCCTAGGTGTTAGGGTAGG - Intronic
920099089 1:203505748-203505770 GATTCCCTGGGAGTGAGGGTAGG - Intronic
920800634 1:209184090-209184112 TAATCCCCATGTGTTGGGGTAGG + Intergenic
922667667 1:227486841-227486863 TATTCCCTATGTGTCAAGGGTGG - Intergenic
922900624 1:229133850-229133872 TAATCCCCATGTGTTAGGGGAGG + Intergenic
924830134 1:247585169-247585191 TATTCCCTAGGTTTTCTTGTAGG - Intergenic
1063797710 10:9531858-9531880 TAATCCCCAGGTGTTAAGGGAGG - Intergenic
1065207225 10:23368619-23368641 TATTGCCCAGGTGGTAGGTTAGG + Intergenic
1066537838 10:36410820-36410842 TTTTCACTTGTTGTTAGGGTGGG + Intergenic
1070425659 10:76284712-76284734 TAATCCCCAGGTGTTGTGGTAGG + Intronic
1071947748 10:90666559-90666581 TAATCCCCAGGTGTTAAGGGAGG - Intergenic
1072841623 10:98780899-98780921 GATTCCCTTGTAGTTAGGGTGGG + Intronic
1076333093 10:129685918-129685940 TATTCCCTAGTTTTGAGGATTGG + Intronic
1076619843 10:131780085-131780107 TCTTCCCTAAGTGGGAGGGTCGG + Intergenic
1079744273 11:24105816-24105838 TAATCCCCATGTGTTAGGGGAGG + Intergenic
1080400135 11:31926946-31926968 TAATCCCTAGGTGTCAAGGGAGG + Intronic
1080502316 11:32882523-32882545 TATTCCCCATGTGTCAGGGGAGG - Intergenic
1080930017 11:36800114-36800136 TATTCCCTCTCTGTTAGTGTGGG + Intergenic
1081037324 11:38165102-38165124 TATTGCCTAGGTTTTATTGTAGG + Intergenic
1081230524 11:40580440-40580462 TAATCCCCAGGTGTTGAGGTAGG - Intronic
1085449746 11:76624760-76624782 TATGCCCCAGGTGTTAGAGAAGG + Intergenic
1085497907 11:76988619-76988641 TAATCCCTATGTGTTGGGGAAGG - Intronic
1086038141 11:82441826-82441848 TATGTACTAGGTGTTAGGCTAGG + Intergenic
1087261810 11:96020520-96020542 TATTCGGTAGGTGTTAAGGGAGG + Intronic
1088498900 11:110462178-110462200 TATTCTCTAGTTGATAGGGTTGG + Intronic
1091215329 11:133897973-133897995 TTTTCCCTAGGGGTTTGGGGTGG - Intergenic
1093990698 12:25586807-25586829 TATACACTAAGTGTTAGGATTGG - Intronic
1096546398 12:52343050-52343072 TACTCCCAAGAGGTTAGGGTTGG + Intergenic
1099491342 12:83292389-83292411 TATTGTCTGGGAGTTAGGGTAGG - Intergenic
1100352773 12:93800449-93800471 TAATCCCCATGTGTTAGGGAGGG + Intronic
1100860782 12:98804132-98804154 TTTTCCCTAGGTGCTAAGGTGGG + Intronic
1102585172 12:113917909-113917931 GATTCCGTAGGTGTTAGAGATGG - Intronic
1102714634 12:114959685-114959707 CATTACCAAGGTGTTAGGTTAGG + Intergenic
1104155958 12:126132614-126132636 TATTCCCTAAGTGTCAAGGGTGG + Intergenic
1106322068 13:28650088-28650110 TATTTCTTAGGTGTCAGGCTTGG + Intergenic
1107096245 13:36539723-36539745 TAATCCCCATGTGTCAGGGTGGG + Intergenic
1107900991 13:45013588-45013610 TTTTCCCCAGGTGTTAGAGAAGG + Intronic
1108771094 13:53700851-53700873 TAATCCCCAGGTGTAAGGGAGGG + Intergenic
1109609418 13:64743981-64744003 CTTTCCCCAGGTGTTAGGCTTGG + Intergenic
1110832166 13:80044134-80044156 TAATCCCCATGTGTTAGGGTAGG + Intergenic
1111737971 13:92165647-92165669 TAATCCCCATGTGTTAGGGGAGG - Intronic
1113265010 13:108607348-108607370 TAATCCCTACGTGTTGGGGGAGG + Intronic
1114676305 14:24442478-24442500 TATTCCCGTGGAGTTGGGGTGGG + Intronic
1114931329 14:27471574-27471596 CATTACCTAGGTGGTAGGGTAGG + Intergenic
1114970964 14:28027777-28027799 TATTCCCTGGTTTTGAGGGTTGG - Intergenic
1115003021 14:28444000-28444022 TAATCCCCATGTGTCAGGGTAGG + Intergenic
1116813104 14:49557966-49557988 TGTTCCCTAAGTTTAAGGGTTGG + Intergenic
1118424622 14:65646609-65646631 CATACCCTAGGTGTGAGTGTTGG + Intronic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1123458472 15:20446535-20446557 CATTCCCTAGGTGGTAGGTGTGG + Intergenic
1123659591 15:22553874-22553896 CATTCCCTAGGTGGTAGGTGTGG - Intergenic
1124254435 15:28129527-28129549 TGTTCCCTAGGTGGTAGGTGTGG - Intronic
1124313454 15:28648369-28648391 CATTCCCTAGGTGGTAGGTGTGG - Intergenic
1133091715 16:3409744-3409766 TTTTCCTTATGTGTTAGGCTGGG - Intronic
1133131768 16:3680546-3680568 TGTTCCCATGGTGGTAGGGTGGG - Intronic
1135831951 16:25782241-25782263 TAATCCCCAGGTGTTAAGGGAGG - Intronic
1135965430 16:27031275-27031297 TATTCCCTTGATGTCAGGCTGGG - Intergenic
1138956089 16:61972037-61972059 TAATCCCCACGTGTCAGGGTGGG + Intronic
1144430075 17:15183283-15183305 TATCACCTAGGTGTTAGTGGAGG - Intergenic
1146784662 17:35708606-35708628 TATTTCCCAGGTCTTATGGTTGG - Intronic
1146932027 17:36784391-36784413 CATTCCCTAGGTGATCTGGTGGG - Intergenic
1147712188 17:42476528-42476550 TATTGCCTGGGTATTAGAGTTGG + Intronic
1151066701 17:71159192-71159214 TAATCCCCAGGTGTTAAGGGAGG + Intergenic
1155592339 18:27441379-27441401 TATTGCCTAGGAATCAGGGTGGG + Intergenic
1156359180 18:36368909-36368931 TAATCCCCAGGTGTGAGGGAGGG - Intronic
1156592823 18:38510708-38510730 TAATCCCCAGGTGTCAAGGTGGG + Intergenic
1156826187 18:41432395-41432417 TAATCCATAGGTGTTAAGGGAGG - Intergenic
1157830612 18:50853986-50854008 TATTCCCTATGAGTCAGGGGAGG + Intergenic
1158308022 18:56127875-56127897 TTTTACCTGGGTGTTGGGGTAGG - Intergenic
1159252609 18:65899552-65899574 TAATCCCCAGGTGTTAAGGGAGG - Intergenic
1159719007 18:71861738-71861760 TATTTCCCAGGTGTTATGGAAGG - Intergenic
1159841582 18:73404743-73404765 TAATCCCCACGTGTTAGGGGAGG - Intergenic
1161489140 19:4552322-4552344 TATGCCCTGGGTGCTAGGTTGGG - Intronic
1163681408 19:18684418-18684440 TACTCCCTGGGTGTTGGGGGAGG + Intronic
1166332740 19:42088273-42088295 CTTTTCCTAGGTGTGAGGGTTGG + Intronic
1166607094 19:44153223-44153245 TTTTCCCAAGGTGTCACGGTTGG + Intronic
1168083686 19:54029328-54029350 TAATCCCCAGGTGTTGGGGGAGG + Intergenic
1168162420 19:54520414-54520436 TATACCATAGATGTTTGGGTAGG - Intergenic
927713484 2:25339811-25339833 TATTGCCTGGGTGTTAGGACTGG - Intronic
928338014 2:30414797-30414819 GATTCCCTAGGTGTGAGGGCTGG - Intergenic
928749010 2:34449539-34449561 TATTCCCTACGTGTCATGGGAGG + Intergenic
929699197 2:44147322-44147344 TAATCCCTATGTGTCAGGGGAGG + Intergenic
929741236 2:44602816-44602838 TAATCCCCAGGTGTCAGGGGAGG - Intronic
931132960 2:59359803-59359825 TAATCCCCATGTGTTAGGGAGGG + Intergenic
932080222 2:68707475-68707497 TAATCCCCATGTGTCAGGGTAGG - Intronic
936752819 2:115666470-115666492 AATTCCCCAGGTGTTAAGGGAGG - Intronic
936800189 2:116257153-116257175 TAATCCCCATGTGTTAGGGGAGG - Intergenic
937554167 2:123133117-123133139 TAATCCCTATGTGTTGGGGGAGG + Intergenic
939351999 2:141050678-141050700 TATTCCCTAGGTTTTATTCTAGG - Intronic
942596698 2:177598396-177598418 TATTTCCTAGGTGTTAGACTTGG + Intergenic
942777926 2:179607268-179607290 TAATCCCCATGTGTTAGGGGAGG + Intronic
942785542 2:179697261-179697283 TATTCCCCAGGTGTTAAGGGAGG + Intronic
943116516 2:183678805-183678827 TAATCCCTAGTTGTTGGGGGAGG - Intergenic
945745280 2:213713168-213713190 TAATCCCTACGTGTTGGGGGAGG - Intronic
947903222 2:233739918-233739940 TAATCCCCATGTGTTAAGGTTGG + Intronic
948773305 2:240263693-240263715 TAATCCCCATGTGTTGGGGTAGG + Intergenic
1170243274 20:14193569-14193591 TGATCCCTAGGTCCTAGGGTTGG - Intronic
1171061833 20:21971897-21971919 TATTCCCAAAGAGTAAGGGTTGG + Intergenic
1171354719 20:24534859-24534881 TATTCCCTGGGTTTGAGGGAGGG + Intronic
1173749237 20:45463612-45463634 TAATCCCCAGGTGTTAAGGGAGG + Intergenic
1173834100 20:46113833-46113855 TAGGCCCTAGGTGGTGGGGTGGG + Intergenic
1174512196 20:51062078-51062100 TAATCCCTATGTGTCAAGGTTGG + Intergenic
1174764239 20:53236941-53236963 TAAGCCCTACGTGTTAGGGGTGG - Intronic
1176340893 21:5694858-5694880 TATTCCATAGGTGATATGTTTGG + Intergenic
1176473147 21:7127011-7127033 TATTCCATAGGTGATATGTTTGG + Intergenic
1176503934 21:7629598-7629620 TATTCCATAGGTGATATGTTTGG - Intergenic
1176915433 21:14620239-14620261 TAATCCCTAGGTGTTGAGGGAGG + Intronic
1177898660 21:26886178-26886200 TAATCCCCAGGTATTAAGGTAGG + Intergenic
1178007444 21:28237496-28237518 GTTTCCCTAGGTGCTGGGGTAGG + Intergenic
1178212957 21:30558940-30558962 TAATCCCTGTGTGTCAGGGTAGG + Intronic
1178471829 21:32900591-32900613 TATTTCCTAGGTTTTCTGGTAGG - Intergenic
1183172609 22:36199057-36199079 CATTTGCTAGGTGTCAGGGTAGG + Intronic
952141014 3:30479330-30479352 TAATCCCCAGGTGTTGGGGGAGG + Intergenic
956036824 3:65102446-65102468 TAATCCCCAGGTGTCAGGGAAGG + Intergenic
957606281 3:82403554-82403576 TAATCCCTAGGTTTTAAGGGTGG + Intergenic
957609358 3:82447948-82447970 TAATCCCTACGTGTTAAGGGAGG + Intergenic
958836978 3:99157421-99157443 TAATCCCTAGATGTTAGGGGAGG + Intergenic
958844857 3:99253704-99253726 TGTAGCCTAGATGTTAGGGTTGG - Intergenic
959006793 3:101028624-101028646 TAATCCCTAGGTGTCATGGGAGG - Intergenic
959383837 3:105676758-105676780 TAATCCCCACGTGTTAGGGAGGG + Intronic
959595971 3:108128801-108128823 TAATCCCCAGGTGTTAAGGTAGG - Intergenic
959914353 3:111799168-111799190 TAATCCCTAGGTGTCATGGGAGG - Intronic
960994071 3:123329635-123329657 CATGCCCCAGGTGTTAGGGAGGG - Intronic
962974989 3:140438264-140438286 TATTCCCCATGTGTGAGGGTGGG - Intronic
964026575 3:152081181-152081203 TAATCCCTATGTGTTAAGGGAGG - Intergenic
965117037 3:164503236-164503258 TCTTCCCTAGGTTTTAGTCTAGG + Intergenic
970634491 4:17992366-17992388 TAATCCCCACGTGTTAGGGGAGG - Intronic
970990658 4:22209546-22209568 TAATCCCCACGTGTCAGGGTAGG + Intergenic
971154648 4:24068417-24068439 TATACCCTAGGTGCTATGCTAGG + Intergenic
971211265 4:24619164-24619186 TATTCCACATGTGTTAGGGAGGG + Intergenic
976032666 4:80776066-80776088 TATTGCCATGGTGTTAGAGTTGG - Intronic
976050864 4:81010033-81010055 TAATCCCCATGTGTTAGGGGAGG + Intergenic
977152141 4:93526104-93526126 TAATCCCCATGTGTCAGGGTAGG + Intronic
977382424 4:96292596-96292618 TAATCCCCAGGTGTCAGGGGAGG - Intergenic
977844136 4:101746565-101746587 TAATCCCTACATGTTAGGGAGGG + Intronic
977852447 4:101846774-101846796 TAATCCCCAGGTGTTAAGGGAGG - Intronic
978252589 4:106650430-106650452 TAATCCCCATGTGTTAGGGGAGG + Intergenic
980652954 4:135744769-135744791 TATGGCCTAGCTGTTAGGTTGGG - Intergenic
983146569 4:164223128-164223150 TAATCCCCAGGTGTTAAGGGTGG - Intronic
983757228 4:171355012-171355034 TATTTCCTAGGTTTTCTGGTAGG + Intergenic
984040459 4:174726491-174726513 TATTCCCTAGAGGTTAGGAAAGG - Intronic
986305211 5:6509325-6509347 TATTCTGTGGGTGTTAGGGATGG - Intergenic
986679771 5:10222223-10222245 TTTGCCATGGGTGTTAGGGTGGG - Intergenic
987857746 5:23443379-23443401 TAATCCCCAGGTGTTAAGGGAGG + Intergenic
988078813 5:26389125-26389147 ACTTCCCTAGGTGGTAGGGCAGG + Intergenic
989441658 5:41479010-41479032 TAATCCCCACGTGTTAGGGGAGG - Intronic
991053732 5:62300128-62300150 TGTTCCATATGTGTTAGAGTAGG + Intergenic
993505909 5:88708337-88708359 TATTCCCCAGCTGTGAGGTTGGG + Intergenic
993989117 5:94634678-94634700 TATTCCCTAGTTGTTGGGAATGG - Intronic
994811801 5:104528717-104528739 TATGACCTAGGTGTTAGTTTTGG - Intergenic
1002610112 5:180412139-180412161 TAATCCCTACGTGTTATGGGAGG - Intergenic
1005585754 6:27274945-27274967 TTTCCACTAGGTGTTAGGGCTGG - Intergenic
1005762007 6:28976116-28976138 TCTTCCATAGGTGTAAGGGCAGG - Intergenic
1008699586 6:54082467-54082489 TAATCCCCAAGTGTTAGGGGAGG - Intronic
1009891497 6:69689427-69689449 TATTTACAAGGTTTTAGGGTTGG + Intronic
1011382522 6:86758525-86758547 TAATCCCTACGTGTCATGGTAGG + Intergenic
1012437243 6:99227336-99227358 TAATCCCCATGTGTTAGGGGAGG + Intergenic
1013396049 6:109741056-109741078 TAATCCCCACGTGTCAGGGTAGG - Intronic
1014375968 6:120674477-120674499 TATGCCCCAGGTGTTATGCTAGG - Intergenic
1016008077 6:139109582-139109604 TAATCCCTAGGTGTTGGGAGAGG + Intergenic
1016613865 6:146024851-146024873 TAATCCCTAGGTGTTGAGGAAGG + Intergenic
1020050071 7:5075606-5075628 TAATCCCCAGGTGTCAGGGGAGG + Intergenic
1021325270 7:19258673-19258695 TAATCCCTACGTGTTATGGGAGG + Intergenic
1027264372 7:76485968-76485990 TCTTCCCTTGGTGCTGGGGTGGG + Intronic
1027315742 7:76984082-76984104 TCTTCCCTTGGTGCTGGGGTGGG + Intergenic
1028118542 7:87029650-87029672 TTTTCCATAGGTGTTATGGCAGG + Intronic
1030735099 7:113038890-113038912 TAATCCCCACGTGTTAGGGGAGG + Intergenic
1031569490 7:123341363-123341385 TATTCTCTTGGGGGTAGGGTGGG + Intergenic
1033717237 7:144015255-144015277 TATTGCCTAGGTTTTATGCTAGG - Intergenic
1033816021 7:145074090-145074112 TAATCCCCAGGTGTTAAGGGAGG - Intergenic
1033958515 7:146882387-146882409 TAATCCCCATGTGTTAGGGGAGG + Intronic
1035239230 7:157519313-157519335 CTTTCCCAAGGTGTGAGGGTCGG + Intergenic
1037061058 8:14509979-14510001 TAATCCCTATGTGTTGAGGTAGG - Intronic
1037586839 8:20282770-20282792 TATTCCTTAGGTGGGTGGGTAGG + Intronic
1039015890 8:33148144-33148166 TTTTCCCTAGGCTTTAGGGGAGG + Intergenic
1044315081 8:90740733-90740755 TAATCCCCACATGTTAGGGTAGG - Intronic
1045325213 8:101112735-101112757 AGTTCCCCAGATGTTAGGGTGGG + Intergenic
1045947602 8:107814174-107814196 TAATCCCTACGTGTAAGGGAGGG + Intergenic
1047572986 8:126121445-126121467 TAATCCCCACGTGTTAGGGGAGG - Intergenic
1051285469 9:15491985-15492007 TAATCCCCAGGTGTTAAGGGCGG - Intronic
1053430384 9:38038389-38038411 GACTCCCTGGGTGTTAGGGAAGG - Intronic
1057142654 9:92736993-92737015 TATCTCCTAGGGGTTTGGGTGGG - Intronic
1057885284 9:98824956-98824978 TAGTCGCTAGGTGTTGGGGGAGG - Intronic
1203422174 Un_GL000195v1:3135-3157 TATTCCATAGGTGATATGTTTGG - Intergenic
1187569035 X:20482335-20482357 ACTTCCTTAGGTGTTAGGGTAGG + Intergenic
1197401921 X:126003299-126003321 TAATCCCCAGGTGTTGAGGTAGG - Intergenic
1201176980 Y:11315462-11315484 TATTCCCCACGTGCTAGTGTGGG - Intergenic
1202073660 Y:21017211-21017233 TATAACCTATGTGCTAGGGTTGG + Intergenic
1202078360 Y:21059065-21059087 TATAACCTATGTGCTAGGGTTGG + Intergenic