ID: 919108735

View in Genome Browser
Species Human (GRCh38)
Location 1:193189962-193189984
Sequence GGTGGATGATTTTCATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919108725_919108735 28 Left 919108725 1:193189911-193189933 CCTTGGTAAAAAGATTAAAAGAG 0: 1
1: 0
2: 3
3: 38
4: 481
Right 919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919108735 Original CRISPR GGTGGATGATTTTCATCTAA TGG Intronic
900078120 1:834392-834414 GGGGGAAGACTGTCATCTAAAGG + Intergenic
901350775 1:8593875-8593897 GGTGCATGGTTTTCTTCTCAAGG - Intronic
901447196 1:9315843-9315865 GGTGGATTTGTTTCATTTAAGGG + Intronic
905141499 1:35848965-35848987 GGTGTATGATCTTCAGCTTAAGG + Intronic
908471374 1:64447236-64447258 GGTGGGTGACTTTCATCTTGGGG - Intergenic
908798725 1:67856918-67856940 GATAGCAGATTTTCATCTAAAGG - Intergenic
911902477 1:103523725-103523747 GGAGGATGATTTTTCTGTAAGGG + Intergenic
914657383 1:149754102-149754124 GGTGGCTGCTTTTCATTAAAAGG + Intergenic
916225343 1:162484504-162484526 GGTGTTTGATTTTTTTCTAAAGG - Intergenic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
922353347 1:224753684-224753706 GGTGGAGGATTTGCTTCTGAAGG + Intergenic
924058523 1:240146942-240146964 GGTGGATGATGTTCTCCTCAGGG + Intronic
1063804321 10:9620787-9620809 GGTGGCTGCTTTTCATTAAACGG - Intergenic
1064609578 10:17084227-17084249 TGTTGATGAATGTCATCTAAGGG + Intronic
1065879938 10:30029381-30029403 GGTGAATGTCTTTCATTTAATGG + Exonic
1073267156 10:102234669-102234691 GGGGGATGATTTGCATTTCAAGG - Intronic
1076344538 10:129771485-129771507 GGTGGATAATTTTTTCCTAAAGG - Intergenic
1078098952 11:8318278-8318300 TGGGGATGATTTTCATCCAAAGG + Intergenic
1080813580 11:35730688-35730710 GGTTCATGGTTTTCATTTAAAGG + Intronic
1082713384 11:56582778-56582800 GGTGGATGATATTAACTTAAGGG - Intergenic
1083463437 11:62830690-62830712 GGTGCATGTTTCTCAGCTAAAGG + Intronic
1084572039 11:69965723-69965745 GTTGGCTGATTTTCATGTCATGG - Intergenic
1086001976 11:81994965-81994987 TGTGGATGATAATTATCTAAAGG - Intergenic
1086456132 11:86960535-86960557 GGTGGATTATTTTGAGCTCAAGG - Intergenic
1087487393 11:98772977-98772999 GCTGGATAATTTTCTTCTAATGG + Intergenic
1089011530 11:115135939-115135961 AGAGCATGATTTTCCTCTAAAGG - Intergenic
1092125734 12:6073915-6073937 GATGGAAGATGTTCATCTAAGGG - Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1104312349 12:127664751-127664773 AGTGGATGATCTACATCTAATGG - Intergenic
1104442240 12:128803139-128803161 AGTGGATGACTTTTATCTGAAGG - Intronic
1113718284 13:112530485-112530507 GGTGGATGTTTTCCAACCAACGG + Intronic
1113987117 13:114326824-114326846 GGTTGCTGATTTTCTGCTAATGG + Exonic
1115182985 14:30651820-30651842 GGCTGGTGATTTTCAACTAAGGG + Intronic
1116176671 14:41479513-41479535 GGAGGATGATTTTACTCTATTGG + Intergenic
1116373420 14:44166089-44166111 GATTGATGATTTCTATCTAAAGG + Intergenic
1116813835 14:49565541-49565563 GGTCCAGGAATTTCATCTAATGG + Intergenic
1120255598 14:82115596-82115618 TGTGGATGATTTTCATGAGATGG + Intergenic
1202847099 14_GL000009v2_random:188141-188163 TGGTGATGATTTTCATTTAATGG + Intergenic
1202916563 14_GL000194v1_random:178703-178725 TGGTGATGATTTTCATTTAATGG + Intergenic
1126282003 15:46964520-46964542 GGGGGCTGCTTTTCATCAAAAGG - Intergenic
1126699383 15:51354430-51354452 TGTGAAGGATTTTCCTCTAAAGG - Intronic
1127759463 15:62123859-62123881 GGCAGATGAGTTTCATCTCAAGG + Intergenic
1131906432 15:97147996-97148018 GGTGGATGATTTTCAGAAAAAGG - Intergenic
1134002166 16:10791406-10791428 GGGGGCTGATTTTCATTAAAAGG - Intronic
1138625974 16:58251974-58251996 GGTTGATACTTTTCATCTATTGG + Intronic
1139753025 16:69120595-69120617 GGTGGATGATTTTCCCATACAGG + Exonic
1141076911 16:81015040-81015062 GGTGAATTATTTTCACCTCAAGG + Intronic
1143965520 17:10754106-10754128 GTTGGCTGATTTTCCTCTGAAGG + Intergenic
1146821201 17:35984699-35984721 GGTGGATGACTTTCAACTCCAGG + Intronic
1148207967 17:45791405-45791427 GGTGGATGATTTCACTCTTACGG + Intronic
1149944408 17:60906146-60906168 GGGGGCTGATTTTTATTTAAAGG + Intronic
1150597709 17:66621236-66621258 GGTGTTTGATTTTCATTAAATGG + Intronic
1153230458 18:2930577-2930599 CCTGTATGATTTTCTTCTAAGGG - Intronic
1158665350 18:59427767-59427789 TGTGGATCACTTTCATCTACAGG + Intergenic
1167025432 19:46913170-46913192 GGTGGAAGATTTTTGTCTTAGGG + Intergenic
1168374218 19:55861950-55861972 TTTGGATGAGTTTCATCTAATGG - Intronic
926545903 2:14239452-14239474 GCTGAATGCTTTTCCTCTAAGGG + Intergenic
926818381 2:16824451-16824473 GGTGCATTTTTTTCATATAAAGG + Intergenic
930251249 2:49036222-49036244 GGTGGCTGATTTTGTTCTCAAGG + Intronic
930832184 2:55756907-55756929 GGTGGTTGTTTTTAATCTGAAGG + Intergenic
935318854 2:101865338-101865360 GGGGGGAGCTTTTCATCTAAGGG + Intronic
943206302 2:184901395-184901417 AGTGGATGACTTTGATGTAAAGG - Intronic
944532559 2:200681549-200681571 GCTGGAGCATTTTCATCCAAGGG + Intergenic
945149725 2:206777383-206777405 GGTTGTTGAATTTCATCAAATGG + Intronic
1169821718 20:9718598-9718620 GTTGGAAGGTTTTAATCTAATGG - Intronic
1176635918 21:9193350-9193372 TGGTGATGATTTTCATTTAATGG + Intergenic
1176637487 21:9261730-9261752 TGGTGATGATTTTCATTTAATGG - Intergenic
1177939947 21:27397646-27397668 AGTGGGTGATTTTCATAAAAAGG + Intergenic
1180371478 22:12041640-12041662 TGGTGATGATTTTCATTTAATGG + Intergenic
1180421525 22:12869227-12869249 TGGTGATGATTTTCATTTAATGG - Intergenic
1184349048 22:43931424-43931446 GGTGGATCATCTTCATTCAAGGG - Intronic
953570053 3:44064164-44064186 CATGGATGATTTTGAGCTAAAGG - Intergenic
955342216 3:58133740-58133762 GGTGAAAGTTTTTCATCTTAAGG - Intronic
958742066 3:98086504-98086526 GATGGATTATTTTGAGCTAAAGG + Intergenic
962853319 3:139323970-139323992 GGTGGTTTATTTCCATCTAGTGG - Intronic
964095006 3:152921080-152921102 GTTGGATCATTTTCATCTTTTGG + Intergenic
964338702 3:155685343-155685365 AGTTGATAATTTTCATCCAAGGG - Intronic
967871513 3:194233702-194233724 TGCGGATGATTTTGTTCTAAGGG - Intergenic
1202749408 3_GL000221v1_random:143290-143312 TGGTGATGATTTTCATTTAATGG + Intergenic
970839208 4:20447118-20447140 GGTTGATGTTTTCCATCCAAAGG - Intronic
972661541 4:41121562-41121584 GGTGGAGGATTTCCATCCTAGGG - Intronic
972931804 4:44080942-44080964 GATGGATGAGTTCCTTCTAAGGG + Intergenic
974200341 4:58629940-58629962 TGAAGATGATTTTCATATAAAGG - Intergenic
974208559 4:58740086-58740108 GATTGATGATCTTCATGTAACGG - Intergenic
975384520 4:73740200-73740222 CATGGATGATTTTCTTTTAATGG - Intergenic
975856431 4:78629778-78629800 GGTGGCTGCTTTTCATTAAAAGG + Intergenic
976612636 4:87045785-87045807 GGTGGAAGCTTTTCATCTGCAGG - Intronic
977508015 4:97926482-97926504 GGTGGAGCATGTTCTTCTAATGG - Intronic
978848557 4:113305578-113305600 GTTGAATAATTTTCATGTAAAGG + Intronic
980839411 4:138239287-138239309 GGGGAATGATTTTCATTTAAAGG + Intronic
1202752382 4_GL000008v2_random:20146-20168 TGGTGATGATTTTCATTTAATGG - Intergenic
985482754 5:127232-127254 GGGGGCTGATTTTCATTAAAAGG + Intergenic
985554564 5:551565-551587 GCTGGAAGATTTTCATCAAGAGG + Intergenic
986065860 5:4233225-4233247 ATTGGATGATTTTAATTTAATGG + Intergenic
986700655 5:10405164-10405186 GGGTGATGATTTTCATTTACAGG + Intronic
986720073 5:10554594-10554616 GGTGGATGATCTGAAACTAAGGG + Intergenic
986903279 5:12463397-12463419 GGTGGCTGATTTTCATCCACAGG - Intergenic
992069725 5:73137499-73137521 GGGGGCTGCTTTTCATCAAAAGG + Intergenic
993983215 5:94567923-94567945 GGTGGGTTATTTTCTGCTAAGGG - Intronic
995827317 5:116315043-116315065 GGGGGCTGCTTTTCATTTAAAGG + Intronic
997747602 5:136312678-136312700 GGTGACTTATCTTCATCTAATGG + Intronic
1003070058 6:2938806-2938828 GGTGTATGACTTTCCTCTAGGGG + Intergenic
1004399254 6:15273371-15273393 AGGGAATGATTTTCAACTAATGG + Intronic
1008399685 6:51050133-51050155 GCTGGATGATTTTCACACAAAGG - Intergenic
1010939364 6:81897520-81897542 TGTGGCTGTTTTTCATTTAATGG + Intergenic
1013872676 6:114785740-114785762 GGTGGCAGAGTTCCATCTAATGG - Intergenic
1019339084 7:499889-499911 GCTTCATGACTTTCATCTAAGGG - Intronic
1019848299 7:3528235-3528257 GTTGGATGATATTCAGCTAGGGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021304263 7:19012108-19012130 AGAGTATGATTTTCATTTAAAGG + Intergenic
1022436920 7:30396051-30396073 GATGGCTGATTTTCTTCTACAGG - Intronic
1023599537 7:41867738-41867760 GGGGTATGATTTTCATTTAAGGG - Intergenic
1024251171 7:47506751-47506773 GGTGTATACTTTTCATCTCAAGG - Intronic
1026914520 7:74111941-74111963 GGTGGATGATGTTCATGGAGTGG - Exonic
1027600157 7:80230426-80230448 GGTGGGTGGTTTTCATCCACAGG + Intergenic
1028885263 7:95925292-95925314 TTTTGATGATTTTCATCAAAAGG - Intronic
1039796480 8:40919781-40919803 GCTGGATGTTTTTCCTCAAATGG + Intergenic
1043658382 8:82702696-82702718 GTTGGATGATTTCCATTGAAAGG - Intergenic
1045712569 8:105002259-105002281 GGTGGATGTATTCCAGCTAATGG - Intronic
1045792203 8:105996549-105996571 GGGGGCTGATTTTCATTAAAAGG + Intergenic
1051128029 9:13826873-13826895 TGTGGATTTTTTTCAGCTAAAGG - Intergenic
1053555372 9:39131920-39131942 GGTGTATGACTGTCATCTGAAGG - Intronic
1053819489 9:41952171-41952193 GGTGTATGACTGTCATCTGAAGG - Intronic
1054109757 9:61095824-61095846 GGTGTATGACTGTCATCTGAAGG - Intergenic
1054611100 9:67235301-67235323 GGTGTATGACTGTCATCTGAAGG + Intergenic
1055647524 9:78375176-78375198 GGTGGGTGATGTGCATCTCATGG + Intergenic
1060298053 9:122356323-122356345 GGTGGATGACTGTCATCAAAGGG + Intergenic
1060383169 9:123196461-123196483 GATGGATAGTTTGCATCTAATGG - Intronic
1203758691 Un_GL000218v1:160691-160713 TGGTGATGATTTTCATTTAATGG + Intergenic
1203718049 Un_KI270742v1:173381-173403 TGGTGATGATTTTCATTTAATGG + Intergenic
1203533171 Un_KI270743v1:4847-4869 TGGTGATGATTTTCATTTAATGG - Intergenic
1203652271 Un_KI270751v1:136929-136951 TGGTGATGATTTTCATTTAATGG + Intergenic
1186057854 X:5669506-5669528 GCTGGATGATCTTCTTCCAAAGG + Intergenic
1190649738 X:52557206-52557228 GGCAGATGTTTTTCATCTTATGG + Intergenic
1192921481 X:75711927-75711949 GGTGGATAATTTTTATTTTAAGG + Intergenic
1193301188 X:79891200-79891222 GGTGTGTGGTTTTCATATAAAGG + Intergenic
1195992549 X:110696890-110696912 GGTGTGTGATTTTGATTTAAGGG + Intronic
1196833390 X:119793504-119793526 GGGTGATGATTTCCAGCTAAGGG - Intergenic
1198618678 X:138483457-138483479 GGTGGAAGGATTTCATCTATGGG + Intergenic
1200376232 X:155783301-155783323 GCTTGATGGGTTTCATCTAAAGG + Intergenic
1201386223 Y:13442335-13442357 GGTGGATGGTTTTCATCTTCTGG + Intronic