ID: 919112216

View in Genome Browser
Species Human (GRCh38)
Location 1:193235280-193235302
Sequence TTGGAGAAGAGAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1918
Summary {0: 1, 1: 0, 2: 17, 3: 197, 4: 1703}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919112216_919112222 15 Left 919112216 1:193235280-193235302 CCTTCCTCCTTTCTCTTCTCCAA 0: 1
1: 0
2: 17
3: 197
4: 1703
Right 919112222 1:193235318-193235340 GTTTCTTCATTTATACAATGAGG 0: 2
1: 20
2: 230
3: 1374
4: 6206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919112216 Original CRISPR TTGGAGAAGAGAAAGGAGGA AGG (reversed) Intronic
900031158 1:373981-374003 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
900031192 1:374102-374124 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051725 1:602230-602252 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900051746 1:602302-602324 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900466426 1:2827750-2827772 TGGGAGAAGGGAAAGATGGAAGG + Intergenic
900466433 1:2827788-2827810 GGGGAGAAGAGAAGGAAGGAAGG + Intergenic
900803495 1:4752178-4752200 AGGGAGGAGAGAGAGGAGGAGGG + Intronic
900808409 1:4782753-4782775 TTGGAGAACAGAAAGAAGAAAGG + Exonic
901088525 1:6626369-6626391 TTGGGCAGGAGAGAGGAGGAGGG - Intronic
901186595 1:7377387-7377409 ATAGAGAACAGTAAGGAGGAGGG - Intronic
901236075 1:7668287-7668309 TCAGAGAAGAGACAGCAGGATGG - Intronic
901452241 1:9342807-9342829 TTGGAGAACAGAAAGGGGAGGGG + Intronic
901501866 1:9657514-9657536 TTGGGGAACGGAAAGCAGGAAGG - Intronic
901686152 1:10944700-10944722 TTGGAGACGAGACAGAGGGAAGG - Intergenic
901854440 1:12035476-12035498 TTGGAGAAGAGCAGGAAGGCAGG - Intergenic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902122203 1:14175839-14175861 TTGGGGAAGGGAAGGCAGGATGG + Intergenic
902156048 1:14487419-14487441 CTGGGGATGAGAAAGGAGGTGGG - Intergenic
902629669 1:17697141-17697163 TTGGAGCACAGCGAGGAGGACGG + Exonic
902743824 1:18459673-18459695 CTGGAGAAGAGAAAGAAAGAGGG - Intergenic
902814395 1:18907960-18907982 CTGAAGGAGAGAAAGGTGGAAGG - Exonic
902844433 1:19098699-19098721 TGGGAGAAAAGAAAGGAGAGAGG + Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903885175 1:26536902-26536924 CTGGAAAAGAGAAAGGAGATTGG - Intronic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
904232708 1:29089887-29089909 TTTGAGATGAGAAAGAAGGAAGG + Intronic
904336024 1:29798644-29798666 TTGGGGAAGAGATATGTGGATGG + Intergenic
904390811 1:30184578-30184600 CTAGAGAAGAGAAAAGAGGGTGG - Intergenic
904471147 1:30737154-30737176 TTGGTGATGAGAAGGCAGGAGGG - Intronic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
904577730 1:31516079-31516101 AAGGAAAGGAGAAAGGAGGAAGG - Intergenic
904807262 1:33140806-33140828 TTGGAGAGGACAACAGAGGAAGG + Intergenic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905262234 1:36728070-36728092 TGGGAGAAGAGAAGGCAAGAAGG - Intergenic
905305396 1:37014345-37014367 GAGGAGGAAAGAAAGGAGGAAGG + Intronic
905337596 1:37256205-37256227 GGGGAGAAGAGAGAGGAAGAAGG - Intergenic
905346408 1:37313971-37313993 GGGGAGAGGAGAGAGGAGGAAGG - Intergenic
905742520 1:40384713-40384735 TTGGAGAAAAGAAAGAAACAAGG - Intronic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
905971845 1:42147538-42147560 TTCAAGAAAAGATAGGAGGATGG - Intergenic
906108872 1:43310263-43310285 AGTGAGAAGAGAAAGGCGGAAGG - Intronic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906642228 1:47448349-47448371 TTGGAGGAGAGGAAGGGGTAGGG + Intergenic
906656507 1:47552265-47552287 TGGGAGATGGGACAGGAGGAGGG - Intergenic
906727740 1:48056016-48056038 TTGGAGAAGAGGGAGGAGCTGGG - Intergenic
906732699 1:48096915-48096937 TTGTTGAAAGGAAAGGAGGAAGG - Intergenic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
907052221 1:51337250-51337272 TTGGAGGTGAGCAAGGAGGCTGG - Intronic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
907365224 1:53953150-53953172 CTGGAGATGAGATAGGAAGAAGG - Intronic
907575083 1:55519065-55519087 TTAGCTAAGAGAGAGGAGGAGGG + Intergenic
907703540 1:56813319-56813341 TGGTAGAAGGCAAAGGAGGAAGG + Intronic
907740025 1:57156364-57156386 TTGGAGAAGAGGAACTAGCAAGG - Intronic
907797984 1:57736778-57736800 TTAGAGAAAAGAAAGAAGGAAGG - Intronic
908053753 1:60260552-60260574 TTTGATAAGAGAAGGTAGGAGGG + Intergenic
908488761 1:64621786-64621808 TTGGAGAATAGGAAGGAGCCAGG + Intronic
908516973 1:64902787-64902809 TTGAAGAAGAGGAAGGACAATGG - Intronic
909275213 1:73675050-73675072 ATGAAGAAAAGAAAGAAGGAAGG + Intergenic
909281293 1:73756971-73756993 TTTGAAAAGAGAAAGAAGGATGG - Intergenic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909498257 1:76304151-76304173 ATGAAGGAGAGAAAGAAGGAAGG - Intronic
909591261 1:77351801-77351823 TAGAAGAAGACAAAGGAGAAAGG + Intronic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910089571 1:83446160-83446182 TTGCAGAGGAGAAATGAGAATGG + Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910588244 1:88902013-88902035 CTGGAGAAGAGAAGGCAGGGTGG - Intergenic
910892803 1:92035027-92035049 TTGAAGAAAAGAGTGGAGGATGG + Intronic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911070417 1:93827741-93827763 AAGGAGGAGAGAAAGGAGAAGGG + Intronic
911303234 1:96201852-96201874 TTGAAGAAGAGAAATGAAGGTGG + Intergenic
911661868 1:100510502-100510524 ATGGAGCAGAGTTAGGAGGAGGG - Intronic
911717415 1:101149613-101149635 TTGTAGTAAAGAAAGGAGGAGGG + Intergenic
912168553 1:107069471-107069493 GAGGAAAGGAGAAAGGAGGAAGG + Intergenic
912344101 1:108948060-108948082 TTTAACAAGAGAAAGAAGGAAGG + Intronic
913158994 1:116128571-116128593 TTGGAAAAGGGAAGGGAGGGAGG - Intronic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913380703 1:118207437-118207459 TGGGGGAACAGAAAGAAGGATGG + Intergenic
913481674 1:119294774-119294796 TTGGAGAACAGGCAGGAGGGTGG - Intergenic
913522578 1:119659784-119659806 TTGTAGAAGAGAGAGGGGGAGGG - Intronic
913676634 1:121146959-121146981 TGGAAGAAGAGAAGGGAGAATGG - Intergenic
913940315 1:125097714-125097736 AAAGAGAAGAGAAAGGAAGATGG - Intergenic
913944296 1:125143154-125143176 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
913954893 1:143280624-143280646 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
913982543 1:143534742-143534764 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
914028530 1:143934909-143934931 TGGAAGAAGAGAAGGGAGAATGG - Intergenic
914677921 1:149917931-149917953 GGGGAGAGGAGAAAAGAGGATGG + Intergenic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
915038769 1:152950176-152950198 TTAGAGAATTGAAAGCAGGATGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915090907 1:153425235-153425257 TTTGAAAAAAGCAAGGAGGATGG + Intergenic
915123753 1:153649169-153649191 ACAGAGAAGAGAAAGGAGGTGGG + Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915424570 1:155813910-155813932 CTAGAGAAGAGAAAGGACAATGG - Intronic
915736807 1:158090368-158090390 GGGGAGAGGAGAAAGGAGGGAGG - Intronic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
915912054 1:159921664-159921686 CTGGAGAAGAGAAGGCAAGACGG + Intronic
915938264 1:160101446-160101468 GGTGAGCAGAGAAAGGAGGAAGG + Intergenic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
917231682 1:172844715-172844737 ATGGAGGAAAGAAAGAAGGAAGG + Intergenic
917405377 1:174700613-174700635 TGGGAGAAGGGAATGTAGGAGGG + Intronic
917502861 1:175601423-175601445 TGGCAGAAGAGAAAGGTGAATGG + Intronic
917535065 1:175868458-175868480 GTGGAGAAGAAAATGGATGATGG - Intergenic
917717666 1:177754391-177754413 GTGGAGAGGAGAAATGAAGAAGG + Intergenic
917720603 1:177783292-177783314 TTGGAGAAGAGAAAGCTGAGAGG - Intergenic
917797394 1:178542134-178542156 TGGGAGCAGAGAAAGGAAGCGGG - Intronic
917837870 1:178954992-178955014 TTGAAGAAGAGAACAGAGGCTGG - Intergenic
917885310 1:179378443-179378465 GTGGAGAAGAGAAAGAATGTGGG + Intronic
918111685 1:181460256-181460278 TTGGAGAATAGATTGAAGGAAGG + Intronic
918471511 1:184880486-184880508 TTAGAGAGGAGAGAGGAAGATGG - Intronic
918514622 1:185349317-185349339 TTGAAGGAGAGAAATGGGGAGGG - Intergenic
918646508 1:186912036-186912058 GAGGAGAACAGAAAGGTGGAAGG - Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919167588 1:193915470-193915492 TTGGAGAACAGAAAGCATGTGGG - Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919318061 1:195999986-196000008 TTGGGGAAGAGATATGTGGATGG + Intergenic
919334474 1:196214425-196214447 TTGGAGAAAAGAATGGAAGCAGG + Intergenic
919594820 1:199548190-199548212 TGGGAGGAAAGAAAGGAGGATGG - Intergenic
919668224 1:200313388-200313410 TTTGAGAAGAGAAGAGAGAAGGG - Intergenic
919852242 1:201680805-201680827 TTGGGACAGAGAAAGGAGAATGG + Intronic
919938153 1:202268492-202268514 TTGGAGTACAGAATGGAGGGTGG - Intronic
920067397 1:203278547-203278569 TTGGCCAGGAGAGAGGAGGAGGG + Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920374878 1:205502894-205502916 GGGGACAAGAGAGAGGAGGAAGG - Intergenic
920463997 1:206165800-206165822 TGGAAGAAGAGAAGGGAGAATGG - Intergenic
920702560 1:208228870-208228892 TTGGAGGAGAGAAAGGAGATTGG - Intronic
920702616 1:208229203-208229225 TTGGAGGAGAGAAAGGAGATTGG + Intronic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
921078964 1:211723767-211723789 CTGGAAAAGAGAAAGGAGGGTGG - Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921530907 1:216281493-216281515 TTAGAGTAGGGAAAGGAAGACGG - Intronic
921815971 1:219563790-219563812 TTTGAGAAGAGAGGGGAGAAGGG + Intergenic
921836295 1:219782378-219782400 TTGGCAAAGAGAACGGAGGATGG - Intronic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922075546 1:222240122-222240144 TTGGAGGTGAGCAAGGAGAATGG - Intergenic
922084026 1:222328242-222328264 TTACAGAAGCCAAAGGAGGAGGG - Intergenic
922416308 1:225426621-225426643 TTGGAGAAGTGAAGGAAAGATGG - Intronic
922426011 1:225494162-225494184 GTGGAGAGGAGAATGGAGGGGGG + Exonic
922445803 1:225696218-225696240 GTGGAGGAGAGAATGGAGGAAGG + Intergenic
922486900 1:225980439-225980461 TACTAGAAGAGGAAGGAGGAAGG + Intergenic
922858598 1:228796075-228796097 GTGAAGAAGAGTATGGAGGATGG - Intergenic
922934244 1:229411381-229411403 TAGGAGAGGAGAGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923209889 1:231794132-231794154 TAGGAAAAGAGAGAGAAGGATGG - Intronic
923492931 1:234500195-234500217 TTCAAAAAGAGAAAGAAGGAAGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923604068 1:235427539-235427561 CTGGAAAAGAGAAGGGAAGATGG - Intronic
923909800 1:238428703-238428725 TTGGACAAGAGAAAGAAATAAGG - Intergenic
924366275 1:243296934-243296956 TTAGAAAATATAAAGGAGGAGGG - Intronic
924369638 1:243334237-243334259 TTGGAGAACAGATAGGAAGGAGG - Intronic
924609237 1:245560094-245560116 CTGGAGAAGGGACAAGAGGAAGG - Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
1062839603 10:659858-659880 CTGGGAAAGAGAAAGCAGGAAGG - Intronic
1063108845 10:3017619-3017641 TGGGAGCAGAGGCAGGAGGAAGG + Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1063663075 10:8047083-8047105 TTGCAGAAGATAAACGAGGTGGG + Intergenic
1063804336 10:9620957-9620979 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
1063919701 10:10920693-10920715 ATGGAGAAAAGAAGGAAGGAAGG + Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064228669 10:13509687-13509709 TTGGGGAGGAGAAAAGAGAACGG + Intronic
1064272683 10:13879729-13879751 GGGGAGAAGGGAGAGGAGGAGGG - Intronic
1064550300 10:16493728-16493750 AGGGAGAAGAGAAAGAAAGAAGG + Intronic
1064554389 10:16534090-16534112 TTTGAGAACTGAAAGGAGGCTGG - Intergenic
1064753497 10:18555140-18555162 ATGGAGAATGGAATGGAGGATGG + Intronic
1064756085 10:18572814-18572836 ATGGAGAATGGAATGGAGGATGG - Intronic
1064756120 10:18573040-18573062 ATGGAGAAGAGAATGGAGAATGG - Intronic
1064756197 10:18573522-18573544 TGGGAGAAGGGAATGGAGAATGG - Intronic
1065776682 10:29126913-29126935 CTGGAGAAGAGAAAGAGAGAGGG - Intergenic
1066004324 10:31133259-31133281 TTAGCGAAAGGAAAGGAGGAAGG + Intergenic
1066220613 10:33334512-33334534 TTGGAGAAAAGAAAGCAGCGAGG + Exonic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066494322 10:35927575-35927597 TTGGAGCAGAGGAAGCGGGAGGG - Intergenic
1066779838 10:38932095-38932117 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1066950180 10:42110376-42110398 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1066951378 10:42121549-42121571 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1067093773 10:43285314-43285336 TTCTAGAAGAGAGAGGAGGAGGG - Intergenic
1067168895 10:43888468-43888490 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1068156718 10:53208079-53208101 GTTGAGGAAAGAAAGGAGGAGGG + Intergenic
1068568952 10:58607431-58607453 TGGGGAAAGAGAATGGAGGATGG - Intronic
1068643425 10:59437143-59437165 TTGGTGAAGAGAGAGGATGAGGG - Intergenic
1068692642 10:59932699-59932721 GTAGAGAAGAGAAGAGAGGAAGG + Intergenic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1069164693 10:65139200-65139222 TTTCAGAAAAGAAAGGATGAGGG - Intergenic
1069318541 10:67138919-67138941 TTGGAAAACAGAAATGAGCACGG + Intronic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1069959526 10:72071513-72071535 TTGCAGAGGAGAAAGGAGTGAGG - Intronic
1070091626 10:73291565-73291587 TTGAAGAAGAGAAAGGAAAAAGG + Intronic
1070106173 10:73433532-73433554 TTGGAGGAAAGAGAGAAGGAAGG - Exonic
1070339462 10:75483714-75483736 TTAGAGAAGAGACAGTAGTAAGG - Intronic
1070340654 10:75495253-75495275 TTGGAAAACAGAAGGGAGGGAGG - Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070506346 10:77116699-77116721 TTGGGGCAGAGAAAGAAGAAGGG - Intronic
1070517424 10:77221191-77221213 TGGGTGAGGAGAGAGGAGGATGG - Intronic
1070643348 10:78184652-78184674 TTTGAGAGGAGAGAGGAGGCTGG + Intergenic
1070675028 10:78406441-78406463 AGGGAGAAAAGAAAGGAGCAAGG - Intergenic
1070838605 10:79467805-79467827 TTGGGGCAGAGAAAGGAAGGAGG - Intergenic
1070891026 10:79942342-79942364 TCTGAGAAGGGAAAGGAGGAAGG - Intronic
1071030240 10:81170727-81170749 TTGGAAAAGAGAAATAAAGAGGG - Intergenic
1071250937 10:83818944-83818966 TTGGAGGAGAGAAGGGAAGAAGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071476691 10:86031688-86031710 TGGGAGAAGGGAAAGGAAGGAGG - Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071714929 10:88085964-88085986 TTGGCAAAGAGAAGGGAAGATGG + Intergenic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071915138 10:90286601-90286623 TTGGGGGAGAGAAAAGAGGGAGG + Intergenic
1071988396 10:91075567-91075589 TTGGACAAGAGGAAAGAGAAGGG + Intergenic
1072033189 10:91540657-91540679 TTGTAGAAGAGAATGTAGGATGG - Intergenic
1072043914 10:91635761-91635783 TTGGATGAGAGAAACTAGGATGG + Intergenic
1072333255 10:94374088-94374110 TTAGAGAATAGAAAGTAGCAGGG - Intergenic
1072413047 10:95222686-95222708 GTGGAGAGGAGAAAACAGGAAGG + Intronic
1072533840 10:96344505-96344527 TGGGATAAGAGAAAGCTGGAGGG + Exonic
1072811707 10:98467500-98467522 AAGGGGGAGAGAAAGGAGGAGGG + Intronic
1073021568 10:100448996-100449018 GAGGAGGAGAGAAAGAAGGAGGG + Intergenic
1073046460 10:100641940-100641962 TTGGAAAGATGAAAGGAGGAAGG + Intergenic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073208009 10:101778837-101778859 TTTGATAAGATAAAGGAGGGAGG - Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073459502 10:103658541-103658563 GTGGAGGGGAGAAAGGAAGAGGG - Intronic
1073638300 10:105221897-105221919 TTAAAGAAGAGAAAGAAGGAGGG + Intronic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1073918447 10:108432024-108432046 CTGGAGAAGAGAAGGCAGGGTGG + Intergenic
1073995841 10:109314427-109314449 CTGGAGAAGAGAAGGCAGGGTGG + Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074197562 10:111202926-111202948 TGGAGGAAAAGAAAGGAGGAAGG - Intergenic
1074460441 10:113631924-113631946 TGGGAGAAGACAAAGGGGAAAGG - Exonic
1074869328 10:117564689-117564711 TGGGTGGAGAGAAAGGAGGGAGG + Intergenic
1074898365 10:117796087-117796109 TTGGAGGGAAGACAGGAGGAAGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075496681 10:122926804-122926826 TTTCAAAAGATAAAGGAGGAAGG + Intergenic
1075540739 10:123311621-123311643 TTAGAGGAGAGGAAGGGGGATGG - Intergenic
1075554313 10:123419161-123419183 GAGGAGAAGAGAAGAGAGGAGGG - Intergenic
1075571262 10:123548006-123548028 TAGGAGATGACAAAGGGGGAGGG - Intergenic
1075605437 10:123802064-123802086 TTGGAGGACAGAAAGGATGCTGG + Intronic
1075702434 10:124478123-124478145 TTGCAGAGGAGGCAGGAGGAGGG + Intronic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076151469 10:128165490-128165512 TTGGAAGAGGGAAAGGAGGTGGG + Intergenic
1076252722 10:128996606-128996628 TTGCAGCAGACACAGGAGGATGG - Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076772875 10:132676681-132676703 TTGGAGCAGAGTCAGGAGGAGGG - Intronic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077279952 11:1739318-1739340 GTGGATAAGAGAAAGGAAGGAGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077644559 11:3912098-3912120 AGGGAGAAGGGAAAGGAGAAGGG - Intronic
1078001829 11:7502958-7502980 TTGGAGAATAGAAAGAAAGAAGG + Intronic
1078082040 11:8211226-8211248 GAGGAGCAGAGAAAGGTGGATGG + Intergenic
1078138614 11:8673548-8673570 TTGGAACAGAGAAAGGAAGTGGG + Intergenic
1078346741 11:10556477-10556499 GTGGAGTAGGGAAAGGAGCATGG + Intergenic
1078469443 11:11575345-11575367 TTTGAGAAGAGAAAGATGTAGGG - Intronic
1078658484 11:13264399-13264421 ATGGAGAAGAGAAAACAGTAGGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078845939 11:15118382-15118404 TTGGAAAGGAGAAAGCTGGAGGG + Intronic
1078973747 11:16446989-16447011 TGGAAGAAAGGAAAGGAGGAGGG - Intronic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079333579 11:19552491-19552513 TGGGAGAAAAGTGAGGAGGAGGG - Intronic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079752340 11:24214645-24214667 TTGGAAAACAGAAAGAAGCAGGG + Intergenic
1079782674 11:24627839-24627861 TTGGAGAAGAGTAAGCTGGAGGG - Intronic
1079840956 11:25398642-25398664 TTGGAATAGATAATGGAGGAAGG + Intergenic
1079852547 11:25555143-25555165 TTGGAGAAGAGAAAGAAGATGGG - Intergenic
1079973944 11:27069556-27069578 TTGGACAAGAGAAAGAAAAAAGG - Intronic
1079993014 11:27266413-27266435 TGGGAGCAGAGAAAGGAGAGTGG + Intergenic
1080053247 11:27878590-27878612 AGGGAGAAAAGAAAGAAGGAAGG - Intergenic
1080064105 11:27989589-27989611 TAGGAGAGAAGAAAGGAAGAAGG - Intergenic
1080230681 11:30015909-30015931 TTGGAGGGGTGAGAGGAGGAGGG - Intronic
1080454849 11:32408751-32408773 TCTGAGAAGAAAAGGGAGGAGGG + Intronic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080708255 11:34720019-34720041 ATGGAGAAGAGCAAGAGGGAAGG + Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080771316 11:35344758-35344780 TTGAAGCTGAGAAAGCAGGAAGG - Intronic
1081051334 11:38345195-38345217 TTGGAAATGAGGAAGGAGCAAGG - Intergenic
1081082956 11:38766425-38766447 GAGGAGAAGAGAGAGGGGGAGGG + Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1081655078 11:44851645-44851667 TATGAGAAGAGAGAGGAGGGAGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1082664310 11:55955528-55955550 TTGAAGAAGAGTAAAGAGGGAGG - Intergenic
1082735887 11:56855063-56855085 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1083182446 11:60995928-60995950 TTGCAGAGGAGAAAGGAGTTTGG + Intronic
1083200658 11:61119210-61119232 TAGGAGAGGAGAGAGCAGGAGGG - Intronic
1083529062 11:63400620-63400642 TTTGAGAAAATAAAGGAGGTGGG + Intronic
1083738690 11:64696086-64696108 GTGGAGGAGAGAAAAAAGGAGGG - Intronic
1083802698 11:65055845-65055867 TGGGAAAAGAGAAAGAAAGAAGG - Intronic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1083929311 11:65831532-65831554 TTTGAGAAAAGGATGGAGGATGG - Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084368879 11:68724626-68724648 CTGGGGAAGAGAAAACAGGAGGG - Intronic
1084441856 11:69179127-69179149 GGGGAGAAGAGAAGGAAGGAGGG + Intergenic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1085223773 11:74899857-74899879 TTCGGAAAGATAAAGGAGGAGGG + Intronic
1085224846 11:74910567-74910589 AAAGTGAAGAGAAAGGAGGATGG + Intronic
1085232174 11:74981765-74981787 TTCTAGAAGAGAAAGGACAAAGG + Intergenic
1085232356 11:74983110-74983132 TTCTAGAAGAGAAAGGACAAAGG + Intergenic
1085262421 11:75214685-75214707 AGGGAGAAGAGAAAGGAACAAGG - Intergenic
1085484362 11:76849369-76849391 TTGGGTAAGACAAAGGAAGAAGG - Intergenic
1085624577 11:78062127-78062149 CAGGAGAGGAGAGAGGAGGAGGG - Intronic
1085750348 11:79155758-79155780 AGGAAGAAGAGAAAGGAGGCAGG - Intronic
1085836952 11:79967007-79967029 GGAGAGAAGAGAAAGGAAGATGG + Intergenic
1086048821 11:82565065-82565087 TTGTTAAAGAGAGAGGAGGAGGG + Intergenic
1086089696 11:82993160-82993182 CTGGAGCAAGGAAAGGAGGAAGG - Intronic
1086853025 11:91833526-91833548 TGGAAGAAGGGAGAGGAGGAGGG + Intergenic
1086855017 11:91855692-91855714 TTAGTGAAGAGAAGGGAAGAAGG - Intergenic
1086956266 11:92937246-92937268 TTGGAGAAAGCAAGGGAGGAGGG + Intergenic
1087034754 11:93743935-93743957 TTGGAGCTGAGAAAGGAGTTAGG - Intronic
1087259187 11:95991724-95991746 CTAAAGAAGAGAAAGGGGGAAGG + Intronic
1087324885 11:96709679-96709701 AAGAAGAAAAGAAAGGAGGAAGG - Intergenic
1087424333 11:97969288-97969310 TTGGAGAAGAGAACAGAGACTGG + Intergenic
1087547350 11:99601710-99601732 TTGGAGAACAGAGATGAGGTGGG - Intronic
1088007405 11:104959681-104959703 ATGGAAAAGAGAATGAAGGATGG - Intronic
1088010651 11:104996788-104996810 GTGGAGAAAATAAAGTAGGAAGG + Intronic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088099692 11:106142195-106142217 TTGGAAAACAGAAAGGGAGAAGG - Intergenic
1088265445 11:107983863-107983885 CTGGAGAAGAGAAGGCAGGGTGG - Intergenic
1088343953 11:108801577-108801599 GTGGTGAAAAGAAAGTAGGAAGG - Intronic
1088422588 11:109665884-109665906 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
1088602545 11:111494132-111494154 ATGGAGATGAGAGAGGAGAAGGG + Intronic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1088808877 11:113376053-113376075 TTGGAGGTGGGAAAGCAGGAAGG + Intronic
1088889093 11:114030707-114030729 TTGGATAAGATAGAGGAGAATGG - Intergenic
1088982371 11:114875313-114875335 TTGTTCAAGAGAAAGGAGTAGGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089384254 11:118057639-118057661 TGGGAGAAGAACAAGGATGAAGG + Intergenic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089793392 11:120960759-120960781 TGGGGGAAGAGAAAGGAGGCAGG - Intronic
1089883830 11:121800528-121800550 TGGGAGACAGGAAAGGAGGAAGG + Intergenic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090236266 11:125150033-125150055 ATGTTGAAGAGATAGGAGGAGGG - Intergenic
1090250683 11:125249438-125249460 TTGGAGAAAAGAAAAAGGGATGG + Intronic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090602872 11:128390863-128390885 TTTGGCAAGAGAAAGGAGGAAGG - Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090957950 11:131530479-131530501 TTACAAAAGAGAAAGGAGGGTGG + Intronic
1091224594 11:133949983-133950005 GCGGGGAAGAGAAAGTAGGAGGG + Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091884280 12:4004528-4004550 TTTGAGGAGAGAAAGGAAGAGGG - Intergenic
1091946094 12:4544452-4544474 ATGGAGAAGAGATGGGCGGAAGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092445479 12:8552423-8552445 TTGGAGGAGACAAAGGAGACAGG + Intergenic
1092645899 12:10571750-10571772 TTGCAGTTGAGATAGGAGGAAGG - Intergenic
1093106016 12:15088035-15088057 AAGGAAAAGAGAAAGCAGGAGGG + Intergenic
1093535292 12:20216277-20216299 TTGGAGAAGAGAAAGAAGCGTGG + Intergenic
1093586314 12:20841295-20841317 TTGCAGAAAAGAAAGTTGGAGGG - Intronic
1093593309 12:20932224-20932246 ATGGTAAAGAGAATGGAGGAAGG - Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1093917459 12:24821550-24821572 TCCGAGAAGAGATGGGAGGAAGG - Intronic
1094019972 12:25903755-25903777 GTGGAGGAGAGAGAGGAAGAGGG + Intergenic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094070021 12:26402875-26402897 TTGGAGTAGTGAAAGGAGGCAGG - Intronic
1094146155 12:27230533-27230555 TTGCATGAGAGAAAGAAGGAAGG - Intergenic
1094269504 12:28596961-28596983 TGGGAGAAGAGAATAGTGGAAGG - Intergenic
1094341788 12:29420306-29420328 GTAGAGGAGAGCAAGGAGGAAGG + Intronic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094712743 12:32981826-32981848 GTGGAGAAGAGATGGGAGGTAGG + Intergenic
1095272608 12:40237517-40237539 AATGAGAAGAGAAAGGAGGGTGG + Intronic
1095275910 12:40282142-40282164 AAGGGGAAGAGAAAGGAGAAGGG - Intronic
1095497424 12:42799534-42799556 ATGGAGAAGTGACTGGAGGAAGG - Intergenic
1095603940 12:44044967-44044989 TTGGGGAAGAGATATGTGGATGG + Intronic
1095752088 12:45724335-45724357 TTGGACAAGAGATGGGGGGAGGG - Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1096196140 12:49649975-49649997 TTGGAGAATAAAAGGGATGAGGG - Intronic
1096235035 12:49920763-49920785 GTGGAGAAGAGAGAGGGTGATGG + Intergenic
1096288854 12:50323882-50323904 TTGGGGAAGAGATATGTGGATGG + Intergenic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096578861 12:52571607-52571629 TGGGAATAGGGAAAGGAGGATGG + Intronic
1096792646 12:54054442-54054464 GGGAAGGAGAGAAAGGAGGACGG - Intronic
1096918794 12:55061621-55061643 TTTAGGAAGAGAAGGGAGGAGGG - Intergenic
1097013267 12:55967722-55967744 TGAGAGAAGAGAAAGGGTGATGG - Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097308455 12:58093958-58093980 TTGGGGAAGAGAAGGAAGGAAGG + Intergenic
1097724831 12:63063578-63063600 TTGCAGAATAGAAAAGAAGATGG + Intergenic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1098325312 12:69296178-69296200 CTGGAGAAGATATGGGAGGAAGG + Intergenic
1098394419 12:70003085-70003107 TGGCAGAGGAGAGAGGAGGAGGG + Intergenic
1098401282 12:70079159-70079181 TGGAAGAGGAGAAAGGAGGGAGG - Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098853102 12:75621037-75621059 TTGAAGAAGAGAAATAAGGTAGG + Intergenic
1099112092 12:78574344-78574366 TTGGAGAATAGAGAGAGGGAAGG + Intergenic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1100084450 12:90892057-90892079 TTGGAGGAGTGAAAGGGAGAGGG - Intergenic
1100184793 12:92127646-92127668 GGGGAGAAGAGGAGGGAGGATGG + Intronic
1100398892 12:94210298-94210320 TTGGATGAGAGAAGGGAGCAAGG + Intronic
1100403823 12:94255428-94255450 TTTGAGCAGAGCAGGGAGGAGGG + Intronic
1100538867 12:95538815-95538837 TTGGAGGAAAGAAAGGAGGATGG + Intronic
1100569546 12:95834667-95834689 TTGGAAAAGAGAAGGGAGTTAGG - Intergenic
1100669785 12:96799100-96799122 TTGGAGGATAGAAGGAAGGAGGG + Intronic
1100872135 12:98921154-98921176 AAGAAGAAAAGAAAGGAGGAAGG - Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101343102 12:103860436-103860458 TTGCAGAATAGAGAGCAGGATGG + Intergenic
1101504701 12:105335469-105335491 TTAAAGAATAGAAAGAAGGATGG - Intronic
1101738685 12:107483020-107483042 TTGGAAAAAAGAAAGAAAGAAGG - Intronic
1101830954 12:108256102-108256124 AGAGAGAAGAGAAAGAAGGAAGG - Intergenic
1101846761 12:108369079-108369101 TGGAAGAAGAGAAAACAGGAGGG - Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1101970859 12:109310765-109310787 TGGCAGAGAAGAAAGGAGGAAGG - Intergenic
1102159411 12:110756441-110756463 ATGGAGAAGAGACAGTAGGCAGG - Intergenic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102553597 12:113711023-113711045 ATGGAGGTAAGAAAGGAGGAAGG - Intergenic
1102577162 12:113863060-113863082 TGGGGGGAGAGAAGGGAGGAGGG + Intronic
1102652454 12:114451835-114451857 AGGGAGAAAAGAAGGGAGGAAGG - Intergenic
1102709042 12:114909124-114909146 TGGGAAAAGGGAAAGGAAGATGG - Intergenic
1102815354 12:115860827-115860849 TGGGAGAAGAAACAGGAAGATGG - Intergenic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103074111 12:117968611-117968633 AAGGAGGAGAGAGAGGAGGAGGG + Intronic
1103087472 12:118072533-118072555 AGGGAGAAGAGAAAGGAAAAGGG + Intronic
1103204787 12:119120135-119120157 GAGAAGGAGAGAAAGGAGGAAGG - Intronic
1103393662 12:120591735-120591757 TAGGGGAAGAGAGAGGAGGTAGG + Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103670552 12:122611373-122611395 TTGGAGCAGAGAGAGGAGAAGGG + Intronic
1103759857 12:123241060-123241082 TTGGAGAGAAGTAAAGAGGATGG - Intronic
1103952916 12:124561383-124561405 TTGGGGAACAGAAACCAGGAGGG + Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1104635493 12:130435855-130435877 TAGGAGGACAGAAAGGACGATGG - Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105703202 13:22949070-22949092 GTGGAGCAGAGTAAGGAGAATGG - Intergenic
1105740207 13:23315813-23315835 TTGGGGAAGAGATATGTGGATGG + Intronic
1105855897 13:24371544-24371566 CTGGAGCAGAGTAAGGAGAATGG - Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1105944057 13:25174906-25174928 TGGGAAAAAAGAAAGAAGGAAGG - Intergenic
1106143942 13:27035301-27035323 CTGGAGCAGAGAGAGGAGAAGGG + Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106672740 13:31923896-31923918 TTGGCCAAGAGAAAGGGGAAGGG + Intergenic
1106927277 13:34626192-34626214 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1107220909 13:37978824-37978846 GAGGAGAGGAGAAAGGAGAAAGG + Intergenic
1107345159 13:39452422-39452444 TTAGAGAAGAGAAAGGGAGGAGG + Intronic
1107435778 13:40379719-40379741 TTGGGAAAGAGAAGGGTGGATGG - Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107560588 13:41553778-41553800 TTAGAGAACAGCAAGGAGGCTGG - Intergenic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107761801 13:43687609-43687631 TTGCAGGAGAGAGAGGAGGGCGG + Intronic
1107873525 13:44768759-44768781 TTGGAGCTGGGAAAGGAGGAAGG + Intergenic
1107923057 13:45229801-45229823 GGGGAGAGGAGAAAAGAGGAGGG - Intronic
1108097343 13:46917358-46917380 TGGGGGAAGAAAAAGGAGGGAGG - Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108331688 13:49391316-49391338 AGGGGGAAGAGAAAGGAAGATGG + Intronic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1108691818 13:52865932-52865954 CTGGAGAAGAGAAAGCTGAATGG + Intergenic
1108722358 13:53145347-53145369 GAGGAGAGGAGAAGGGAGGAGGG - Intergenic
1108732478 13:53248966-53248988 TTGGGGGAGAGAAAGGAGAGAGG + Intergenic
1109209242 13:59515479-59515501 TTGGACAAAAGAAAAGGGGATGG + Intergenic
1110214255 13:73009041-73009063 TGGTTGAAGAGAAAGGAAGAGGG - Intronic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110515795 13:76411308-76411330 ATGGAAAAGGGAAAGGAGTAGGG + Intergenic
1110796538 13:79645129-79645151 TTGGAGAATAGAGGGGAAGAAGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111226727 13:85283192-85283214 TTGTAGAAGAGAAAGTATGGTGG + Intergenic
1111695437 13:91617639-91617661 AGGGAGAAAAGAAAGGAGGGAGG - Intronic
1111860008 13:93691214-93691236 TTGGGGTAGAGAAAGGAGGCTGG - Intronic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1111965877 13:94861004-94861026 GGGGAACAGAGAAAGGAGGAAGG + Intergenic
1111986659 13:95072749-95072771 GTGAAGAACAGAAGGGAGGAAGG - Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112228843 13:97567848-97567870 CTGGATAAGAGAAAGGATGCTGG + Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112674148 13:101678862-101678884 TTGGGGAGGAGAAAGGAGTAGGG - Intronic
1113086261 13:106572313-106572335 TTGGAGAAGGGAATGGAGGAAGG - Intergenic
1113109578 13:106807884-106807906 TAGGTGAAGGGAATGGAGGAAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113292689 13:108923614-108923636 TTGGGGCAGTGAAAGCAGGAAGG - Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1113966720 13:114156666-114156688 TCAGAGAAGAGAAGGGAGGCAGG - Intergenic
1114469807 14:22952508-22952530 TGGGAGAAGAGATAAGAAGAAGG - Intronic
1114482849 14:23046194-23046216 TTGCAGAACACAAAGGAGGAGGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114540119 14:23449088-23449110 CTAGAGAAGAGAAAGGGGAAGGG + Intergenic
1114840313 14:26255389-26255411 GTGGAGAAGAGACTGGAAGAGGG + Intergenic
1115256379 14:31407045-31407067 TTCGAGAGGACAAAGCAGGAGGG + Intronic
1115275601 14:31605813-31605835 GAGGAGACGAGAAAGGAGAAGGG - Intronic
1115497825 14:34024544-34024566 GAGGAGAAGAGAAGGGAGAAGGG - Intronic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1115953911 14:38754979-38755001 TTGGAGAGAAGAAAGCAGAAGGG + Intergenic
1116135781 14:40921758-40921780 TGGGAGGAGAGGGAGGAGGAGGG - Intergenic
1116249136 14:42458266-42458288 TTGGGGAAGAGATATGTGGAAGG + Intergenic
1116255291 14:42547489-42547511 ATGGACAAGAGAGAGGCGGAAGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116967771 14:51031946-51031968 GTGGAGGGCAGAAAGGAGGAGGG + Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117444026 14:55786826-55786848 TTTGAGGAGAGCAGGGAGGAAGG - Intergenic
1117610813 14:57481240-57481262 TTGGTTTAGTGAAAGGAGGAGGG - Intronic
1118370893 14:65136340-65136362 TAGGACAAGAGAACGAAGGAAGG + Intergenic
1118434538 14:65757499-65757521 TCGGAGAATAGCAAGGAGGCTGG + Intergenic
1118571838 14:67201876-67201898 TAGAAGAAGAGACTGGAGGATGG - Intronic
1118657204 14:67965441-67965463 TTTGACAAGAGTATGGAGGATGG - Intronic
1118706225 14:68483014-68483036 TAGGGGAAGGGAAAGGTGGATGG + Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118811115 14:69274748-69274770 TTTGAGAATAGACTGGAGGACGG + Intronic
1118907555 14:70033625-70033647 TTGGGGAAGAGAAATAAGGCAGG + Intergenic
1119053971 14:71399646-71399668 TGGGAGCAGAGAAGAGAGGATGG - Intronic
1119545626 14:75469522-75469544 GTGACGAAGAGAGAGGAGGAGGG + Exonic
1119680006 14:76585104-76585126 TGGGAGAAGGGAAAGAAGGAGGG + Intergenic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120337947 14:83182580-83182602 TTGGACAAGGGAAGGGAGAATGG + Intergenic
1120519310 14:85508202-85508224 AAGGAAAGGAGAAAGGAGGACGG + Intergenic
1120878728 14:89398088-89398110 TTGGGGAAGCCAAAGGAGAAGGG - Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121039248 14:90731478-90731500 TTGGGGAAAAGAAAGGTAGAAGG + Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121399979 14:93667110-93667132 TTGAAAAAAAGAAAGAAGGAAGG + Intronic
1121447731 14:93988800-93988822 TGGGAGAAGGGATGGGAGGAAGG + Intergenic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121548090 14:94777441-94777463 TTGGGCAAAACAAAGGAGGAAGG - Intergenic
1121595819 14:95161461-95161483 TTGGAGAAGAGAAGGGTTGAAGG + Intergenic
1121878166 14:97473838-97473860 GTGGGGAAGAGTCAGGAGGAGGG + Intergenic
1121911001 14:97792465-97792487 TTGGTGCAGAGAAGGGAGCAGGG - Intergenic
1122064779 14:99165216-99165238 TAGGAAAAGAGAAGGCAGGAAGG + Intergenic
1122156590 14:99753817-99753839 GTGGGGAAGAGAAAACAGGATGG - Intronic
1123143741 14:106108363-106108385 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123191841 14:106579133-106579155 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123206829 14:106721337-106721359 TTGCAGGAGAGAACCGAGGAGGG + Intergenic
1123220552 14:106851502-106851524 TTGGAGAACAGCCAGGACGAGGG + Intergenic
1123395801 15:19933739-19933761 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1123432450 15:20230080-20230102 GAGGAGAAGAGAAGGGAAGAGGG + Intergenic
1124109948 15:26775773-26775795 AGGGAGCTGAGAAAGGAGGAAGG - Intronic
1124993588 15:34700371-34700393 GGGGAGAAGGGAGAGGAGGAGGG - Intergenic
1125005863 15:34816935-34816957 CTGGAGAAGAGAAAAAAGGGGGG + Intergenic
1125208424 15:37182199-37182221 TTGGAGAAAGGAAGGAAGGAAGG - Intergenic
1125368329 15:38942924-38942946 AGGGAGAAGAGCAGGGAGGAAGG + Intergenic
1125372729 15:38995725-38995747 ATGGATAAGAGACAGGAGAAGGG - Intergenic
1125697553 15:41651803-41651825 GAGGAGAAGGGAAAGGAAGAGGG - Intronic
1125721962 15:41849469-41849491 TTGGAGAGGGGAGAGGAGGGAGG + Intronic
1125826768 15:42683058-42683080 ATGGAGAAAAGAAACAAGGAAGG - Intronic
1126082732 15:44981476-44981498 TTGGCCAAGAGAAAGAAAGAAGG + Intergenic
1126189635 15:45866207-45866229 TGTGAAAAGAGACAGGAGGAGGG - Intergenic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126283692 15:46986910-46986932 TTGGGGAAGAGATATGTGGATGG + Intergenic
1126392628 15:48176486-48176508 CAGGAAAAGAGAAAGGAGAAAGG - Intronic
1127014381 15:54666956-54666978 TTGTAGCAGGGAAAGGAGAAAGG + Intergenic
1127237393 15:57069788-57069810 TGGGAAAAGAGAGAGGAGAAAGG + Intronic
1127295552 15:57605751-57605773 TTGCAGAAGGGAAAAGATGAGGG + Intronic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127708776 15:61574508-61574530 TTGGAGAACAGATGGGAGAATGG + Intergenic
1127854340 15:62942413-62942435 TTGGAGGTTAGGAAGGAGGATGG - Intergenic
1127889645 15:63238302-63238324 CTGGAGACTAGAAAGAAGGAGGG - Intronic
1127983438 15:64050616-64050638 GGGGAGGAGAGAAGGGAGGAAGG + Intronic
1128224040 15:65989365-65989387 CTGGAGAGGAGAAGGGAGGTGGG - Intronic
1128678798 15:69631327-69631349 TGGGAGCAGAGCAAAGAGGAGGG + Intergenic
1128683032 15:69665297-69665319 TTGGAGAAGAGAGAGGGAGGGGG - Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129089886 15:73137960-73137982 TTAGAGGAGAGAAAGGAAGAGGG + Intronic
1129329198 15:74818214-74818236 TGGCAGAAGAGAGAGGAGCAGGG - Intronic
1129521502 15:76189331-76189353 AGGGAGCAGAGAAAGAAGGAGGG + Intronic
1129624804 15:77185672-77185694 TTGGAGAAGAGTAGGCAGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129765040 15:78159297-78159319 TGGGGGAAGAAAAAGGAGGAGGG - Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1129929855 15:79401738-79401760 ATGGAAAAGAGAAACGAGGGTGG + Intronic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130101551 15:80898455-80898477 TTAAAGATGGGAAAGGAGGAAGG + Intronic
1130305160 15:82708582-82708604 GTGGAGAAGAGATTGGAGGTGGG - Intronic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130813514 15:87406638-87406660 TGGAAGGAGAGAAAGAAGGAAGG + Intergenic
1130833444 15:87626522-87626544 TTGGAGAAGTGAAAGGGGCTTGG + Intergenic
1130910458 15:88267036-88267058 TTGGAGGAGAGAGAGCAGGGAGG + Intergenic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131146180 15:90014336-90014358 TTGGAAGAGAGGAAGGAGAAGGG + Intronic
1131359018 15:91772754-91772776 GCGGAGAAGAGAAAGAGGGAAGG - Intergenic
1131402341 15:92135152-92135174 TTGGAAGAGAGAAAGCTGGAGGG + Intronic
1131438989 15:92444530-92444552 TTGGGGATGAGAAAGAAGCAAGG + Intronic
1131546103 15:93316779-93316801 TTGGCGAATGGATAGGAGGAGGG + Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131926597 15:97391237-97391259 TTGTGGAAGAGAAAGTAGGATGG + Intergenic
1132304487 15:100801565-100801587 CTGGAGAAGAGAAGGAAGGCAGG + Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133578888 16:7123900-7123922 GTGGAGAAGAGAAAGGAGAGAGG + Intronic
1133595261 16:7284952-7284974 TTGGCGAGGAGAAAGGTGGGTGG - Intronic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133706043 16:8355611-8355633 CTGCAGAAGAGAATGGAGCAAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134384180 16:13756602-13756624 TTTGACAAGGGAAAGGAAGATGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134902906 16:17954636-17954658 TGGGAGGAAAGAAAGGAGGAAGG + Intergenic
1135046148 16:19157573-19157595 TTCCATAAGAGAAAGGAAGATGG + Intronic
1135077714 16:19408692-19408714 ATGGCTTAGAGAAAGGAGGAGGG - Intergenic
1135172301 16:20196140-20196162 TTGCAGAAAATAAAAGAGGAAGG - Intergenic
1135323829 16:21513467-21513489 TTGGCAAAAAGAAAGGAGCAAGG - Intergenic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1135383161 16:22010125-22010147 TTGGGGGAGAGAAGGGAGGGAGG - Intronic
1135396123 16:22132874-22132896 GTGGGGAAGAGAAGGTAGGAGGG - Intronic
1135835279 16:25819719-25819741 TTGGAGAATAGACAGGCTGAGGG + Intronic
1135956398 16:26959901-26959923 TGGGGGAAGAGAAAGAGGGAGGG - Intergenic
1136014676 16:27388462-27388484 TTAGGCAGGAGAAAGGAGGAAGG + Intergenic
1136044442 16:27604039-27604061 ATGGAGAATAGAAAGTGGGAAGG - Intronic
1136141913 16:28293465-28293487 TGGGGGAAGGGAGAGGAGGAGGG - Intronic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136361895 16:29785905-29785927 ATGGAGAAGAGAATGGGGGCTGG - Intergenic
1136698247 16:32105884-32105906 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136769357 16:32821953-32821975 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136798750 16:33049181-33049203 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136901124 16:34038938-34038960 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136935580 16:34460887-34460909 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136938408 16:34498553-34498575 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136939635 16:34510728-34510750 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1136948965 16:34691624-34691646 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136956455 16:34792135-34792157 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136960185 16:34837832-34837854 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136961411 16:34850004-34850026 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136964238 16:34887683-34887705 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1136968388 16:34942372-34942394 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1137088855 16:36162914-36162936 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1137093384 16:36222154-36222176 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1137218661 16:46426421-46426443 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137768070 16:50993018-50993040 AGGGAGAGGAGAAAGGAGAAGGG + Intergenic
1137821527 16:51449922-51449944 AGTGAGAAGAGAAAGCAGGAAGG - Intergenic
1137863686 16:51871795-51871817 AAGGAGAAGAGAAGGAAGGAGGG + Intergenic
1137928422 16:52563761-52563783 GTGAAGAGGAGAGAGGAGGATGG + Intergenic
1138101645 16:54256661-54256683 GAGGATTAGAGAAAGGAGGAGGG - Intronic
1138450519 16:57091461-57091483 TTGGAGAAAGGAAAGATGGATGG + Intergenic
1138544358 16:57706860-57706882 TGGGAGGAGAGAGGGGAGGATGG - Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1139319009 16:66097785-66097807 TGGGAGAAGAGAAAGGGACAGGG - Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139424950 16:66873762-66873784 TAGGAGGAGGGAGAGGAGGAGGG - Intergenic
1139637648 16:68267824-68267846 GGGGAGGGGAGAAAGGAGGAGGG + Intronic
1139656450 16:68389935-68389957 TTAGAGAAGAAACAGAAGGATGG + Intronic
1139868945 16:70088152-70088174 TTGTAGAAGTGAAAGGAGATGGG - Intergenic
1139897739 16:70301111-70301133 AAAGACAAGAGAAAGGAGGAAGG - Intronic
1140027257 16:71301829-71301851 CTGGAGCAGTGAAAGGATGAAGG + Intergenic
1140122340 16:72094228-72094250 TTTGACCAGAGCAAGGAGGAAGG - Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140334723 16:74094709-74094731 TTGGGGAAGTGAAAAAAGGAAGG - Intergenic
1140386443 16:74544020-74544042 TTGGAGAAGTGAAAGGAGATGGG + Intronic
1140426739 16:74867496-74867518 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
1140857472 16:78990643-78990665 TGAAAGAAGAAAAAGGAGGAAGG + Intronic
1141047911 16:80733829-80733851 GTGGAGATGAGATTGGAGGAAGG - Intronic
1141399571 16:83735335-83735357 TTGAAGAAGAGAAAGGACAGTGG - Intronic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1141950814 16:87338405-87338427 AAGGAGCAGAGAAGGGAGGATGG - Intronic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142053975 16:87980384-87980406 TTAGAGAAAAGGAAGGAGGTTGG + Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1203071773 16_KI270728v1_random:1084058-1084080 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1203141389 16_KI270728v1_random:1769416-1769438 TTGCAGATGAGATAAGAGGAAGG + Intergenic
1142526232 17:543774-543796 ATGAAGAAGAGAAGGAAGGAAGG + Intronic
1142581062 17:943091-943113 TTGGTGCAGGGAAGGGAGGAGGG - Intronic
1142588788 17:991576-991598 TTGGAGAAGAGCAAGGTAGGAGG + Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143055452 17:4158763-4158785 TAGGAGGAGGGAAGGGAGGATGG - Intronic
1143104574 17:4522577-4522599 TGAGAGAAGAGAAAGAGGGAGGG - Intronic
1143185149 17:5005626-5005648 TTGCAGAAGAGAAAGCAGTAAGG + Intronic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143552954 17:7642483-7642505 TTGGAGGAGAGAACGGAGGAGGG - Intergenic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143738117 17:8928199-8928221 TGGGAGAGGAGAAAGAAGGCCGG + Intronic
1143738132 17:8928302-8928324 TGGGAGAGGAGAAAGAAGGCAGG + Intronic
1143765524 17:9135142-9135164 ATGGGGTAGAGAAGGGAGGATGG - Intronic
1143935283 17:10477558-10477580 TTGGAGAGGAGAGAGAAGAAAGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144066023 17:11624741-11624763 TGGGAGGAAAGAAAGAAGGAAGG - Intronic
1144087535 17:11824127-11824149 CTGGAGAAGAGAAAATAGAAAGG - Intronic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144377963 17:14664487-14664509 TGGGAGAAGAGAGAAGCGGAAGG + Intergenic
1144378253 17:14667136-14667158 GGGGAGAAGAGAAAAGAGGTAGG + Intergenic
1144386884 17:14756202-14756224 GTGGAGAAAAGAAAGGAAGGGGG - Intergenic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1144771533 17:17762272-17762294 TTGGAGAAGACCCAGGAGGATGG + Intronic
1145030047 17:19497920-19497942 TTTGAGAGGAGAAATGAGAAAGG + Intronic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145692415 17:26756148-26756170 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1145709148 17:26952780-26952802 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146125826 17:30230669-30230691 GTGGAGAAGAGAAAAGAGAGGGG + Intronic
1146138102 17:30340872-30340894 TCAGAGAAGAGAAAAGAGAATGG + Intergenic
1146318131 17:31825201-31825223 TTGGAGAAGAGAAAAGGAGGGGG - Intergenic
1146320895 17:31845525-31845547 ATGGAGAGGAGAATGAAGGAGGG + Intergenic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146691723 17:34881398-34881420 TAAGAGAAGAGAAAGTAGCAAGG + Intergenic
1146920157 17:36704705-36704727 GTGATGGAGAGAAAGGAGGAAGG - Intergenic
1146978261 17:37135015-37135037 GAGGGGGAGAGAAAGGAGGAAGG + Intronic
1147003130 17:37379389-37379411 TTGGAAAAGAGGAAGGGGGCAGG + Intronic
1147232055 17:39026933-39026955 TTGGAGAGCAGAACTGAGGACGG + Intergenic
1147495285 17:40909549-40909571 TTTGAACAGAGAAAGAAGGATGG - Intergenic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148334503 17:46832411-46832433 GTGGAGGAGAGAAGGGAGGTTGG + Intronic
1148541273 17:48482542-48482564 GTGGTGAACAGAGAGGAGGAGGG + Intergenic
1148749029 17:49934296-49934318 CTGGAGGAGAGAACAGAGGATGG - Intergenic
1148868542 17:50642143-50642165 TGGGAAGAGAGACAGGAGGAAGG + Intronic
1149184957 17:53986513-53986535 TTGTAAAAGGGAAAGGAGGGAGG - Intergenic
1149314100 17:55422205-55422227 TTGGAGAAGAGATCGAGGGAGGG + Intergenic
1149508947 17:57221183-57221205 TTGGAGAAGAGAGGGAGGGAGGG + Intergenic
1149628008 17:58093680-58093702 GTAGAGAGGAGTAAGGAGGAGGG - Exonic
1149665784 17:58363998-58364020 AAGGAGAAGAGAGAGGAAGAAGG + Intronic
1149689170 17:58559514-58559536 TTGGTGAAGAGAAAAGAAAAAGG - Exonic
1149778757 17:59379360-59379382 TTGGAGAAAAGAATGGAAAAAGG + Intronic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1150062394 17:62079821-62079843 TTGGTGATAAGAAAGGAAGATGG + Intergenic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150150645 17:62806555-62806577 TAGGGAGAGAGAAAGGAGGAGGG + Intronic
1150239382 17:63620056-63620078 TGGGAAAACAGAAAGGAGCATGG + Intergenic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1150810005 17:68348746-68348768 TTGGAGAAGAGATAGAATGAAGG + Intronic
1150810282 17:68350838-68350860 CTGGAGAAGAGATAGAAGGAAGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150856247 17:68755796-68755818 GTGGAGAAGGGAGAGGAGAAGGG - Intergenic
1150880425 17:69019475-69019497 TTGAAGAAGAGAGAGGAGAATGG - Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1150911314 17:69390418-69390440 TTGGAGAAAAGAAAGGAGAGGGG - Intergenic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151078494 17:71301515-71301537 AGGGAGAAAAGAAAGGGGGAAGG - Intergenic
1151116589 17:71742547-71742569 TTGGAGACTAGAAAGGGAGAGGG + Intergenic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1151383734 17:73742787-73742809 TGGGAGAAGAGCAAGGAACACGG + Intergenic
1151396830 17:73828250-73828272 GTGCAGGAGAGAAAGGATGAAGG - Intergenic
1151673561 17:75586782-75586804 AGGGAGGAGAGAAGGGAGGAAGG + Intergenic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1151751387 17:76040287-76040309 TTGGGTAAGAGAAGGGAGGGAGG + Intronic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1152107118 17:78337005-78337027 ATTGGGGAGAGAAAGGAGGAAGG + Intergenic
1152201091 17:78946747-78946769 GGGCAGAAGAGGAAGGAGGAAGG - Intergenic
1152291445 17:79442187-79442209 TGGCAGAAGAGAGAGGAGGAGGG + Intronic
1152577931 17:81151043-81151065 TGGGACAGGAGAAGGGAGGAAGG + Intronic
1152620744 17:81363525-81363547 TGGGAGGAGAGATAGGAGGTCGG - Intergenic
1152948461 17:83211611-83211633 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1152948495 17:83211732-83211754 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1203183936 17_KI270729v1_random:93700-93722 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1153312285 18:3688836-3688858 CTGGAGACCAGAAAGGAGGCCGG - Intronic
1153332535 18:3888674-3888696 TTTGAGAATAAAAAGGTGGAAGG + Intronic
1153585047 18:6612349-6612371 TTGGAGAGAAGCAAAGAGGACGG - Intergenic
1153639392 18:7143546-7143568 TTAGAAAAGGGACAGGAGGAAGG + Intergenic
1153957836 18:10113288-10113310 TGAGAGAAGGGAAAGGAGGGAGG - Intergenic
1154372976 18:13782017-13782039 TTCCAGAATAGAAAGGAGAAGGG + Intergenic
1154515811 18:15164443-15164465 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1154519103 18:15207967-15207989 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1155077224 18:22369644-22369666 TTGGAGAAGTGAATCGAGGAAGG - Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155280872 18:24238361-24238383 TGGGAGAAGGGAAAGGAACATGG - Intronic
1155438403 18:25836333-25836355 TTGGAGAAGAGTAAGGAGATGGG + Intergenic
1155678753 18:28463477-28463499 TGGCAGAAGGCAAAGGAGGAGGG + Intergenic
1155742957 18:29313176-29313198 TTGGAGAGTAGAAATGAGGCAGG + Intergenic
1155764878 18:29615949-29615971 TTGGAGAAGGGAGAGGATCAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156013217 18:32517758-32517780 TGGGAGAGGGGAAAGGAGAAGGG - Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156392776 18:36666221-36666243 CTGGAGAATAGAAAGCAAGAGGG + Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156777310 18:40807692-40807714 TTGGAGAAGAGAGAGAGGGAGGG - Intergenic
1156826338 18:41434443-41434465 GTGGGGGAGGGAAAGGAGGAAGG + Intergenic
1156984212 18:43329760-43329782 TGGGACTACAGAAAGGAGGAAGG + Intergenic
1157220406 18:45825253-45825275 AGGGAGAGGAGAAGGGAGGATGG + Intergenic
1157575812 18:48742291-48742313 TAGGGGAAAAGAAAGGAGCAGGG + Intronic
1158288535 18:55912715-55912737 ATGGATCAGAGAAAGGAGAAAGG - Intergenic
1158329666 18:56347596-56347618 TTGGAGAGGAGGATGGAGCATGG + Intergenic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1159238073 18:65703426-65703448 AGGGAGAAGAGAAACAAGGAGGG + Intergenic
1159402322 18:67954471-67954493 TTGGAGAAGACAAAAGGGGATGG + Intergenic
1159527903 18:69617607-69617629 TAGGAGAAAAGAAAGAAAGAGGG + Intronic
1160067181 18:75586574-75586596 ATGGAGAGGAGAGAGGAGGGAGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160408354 18:78658642-78658664 GTGGTGGAGAGAAAGGAGGAGGG + Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1161415676 19:4145274-4145296 GGGGAGGAGGGAAAGGAGGAGGG + Intergenic
1161881185 19:6954206-6954228 TTAGAAACGAGAGAGGAGGAAGG + Intergenic
1161955216 19:7490171-7490193 TTGGAGAAGTGACAAGACGAAGG - Intronic
1162161930 19:8724609-8724631 TTTGGGAAGAGAAGTGAGGATGG - Intergenic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1162459018 19:10803333-10803355 TAGGTGAGGAGAAGGGAGGAAGG + Intronic
1162766512 19:12923054-12923076 TAGGAGAAGAGTGAGGAGGCTGG - Intronic
1162954996 19:14092510-14092532 TGGGAGTAGAGGAAGGAGGGAGG + Exonic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163171172 19:15532259-15532281 AAGAAGAAGAGAAGGGAGGAGGG - Intronic
1163370087 19:16896890-16896912 TTGTAGGAGAGAAAGGAGACAGG + Intronic
1163547941 19:17950482-17950504 TTCAAGAAGAGAAGGGAGGTGGG + Intergenic
1163654304 19:18536923-18536945 TGGGAGAAGTGATAGCAGGAGGG + Intronic
1163655329 19:18542520-18542542 TTGGAGAAGAGGCTGGAGGTGGG - Intronic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164439978 19:28269287-28269309 AAAGAGAAGAGAAAGAAGGAAGG - Intergenic
1164551847 19:29218711-29218733 ATGGAGGAAAGAAAGGACGAGGG + Intergenic
1164585818 19:29475230-29475252 TGAGAGAAGAGAGGGGAGGAAGG + Intergenic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1164744938 19:30604894-30604916 CTGGAGAAGGGACAGCAGGAAGG + Intronic
1164774200 19:30839006-30839028 TTGTAGAAGAGAAATAGGGAAGG - Intergenic
1164794377 19:31014488-31014510 AGGGAGAAAAGAAGGGAGGAAGG + Intergenic
1164806348 19:31120157-31120179 TTGGAGAACAGAAGACAGGATGG - Intergenic
1164863602 19:31583472-31583494 TGGGAGAAGAGAAAGAAGAGGGG + Intergenic
1164967143 19:32495157-32495179 TAGGGGTAGAGAAAGGAGGTAGG + Intergenic
1165021247 19:32926048-32926070 TTAGAGGACAGAAAGGAGGAAGG - Intronic
1165054744 19:33167732-33167754 GGAGAGAAGAGAAAAGAGGAGGG - Intronic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165545229 19:36529496-36529518 TTGGAGGACAGAAATGAGAAGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165640922 19:37385793-37385815 TTGGAAGAGAGAAGGGAGTAAGG - Intronic
1165711128 19:38011777-38011799 GTGGAGAATAGAATGTAGGAAGG + Intronic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1166512381 19:43417799-43417821 TTGGGGAAGAGAAGGCAGCAAGG + Intronic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1166613012 19:44216599-44216621 TGGGAGAAGAGAAGGCAGGATGG - Intronic
1166704021 19:44898372-44898394 GTGGAGAAGGGAAGGGAGGTTGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167079768 19:47271027-47271049 GTGGAGAGTAGACAGGAGGAAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167939301 19:52933439-52933461 TTGCAGTTGAGAAAAGAGGAAGG - Intronic
1168259379 19:55184944-55184966 ATGCAGAAGAGAAGGGAGAAAGG - Intronic
1168318597 19:55495030-55495052 CTGGATAAGAGAAAGGATGCTGG + Intronic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
1168542433 19:57224321-57224343 TTGGTTAGGAGACAGGAGGAAGG - Intergenic
1202682412 1_KI270712v1_random:19066-19088 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
925184373 2:1836921-1836943 TTGGAGAAAAGAAACAGGGAAGG + Intronic
925288964 2:2734026-2734048 CTGGGGTAGAGAAAGGAGGGTGG - Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925501180 2:4506767-4506789 TTGGTAAAAAGAATGGAGGAAGG + Intergenic
925559757 2:5178252-5178274 TTTGGGAAGAAAAGGGAGGATGG + Intergenic
925891108 2:8435423-8435445 TAGCAAAAAAGAAAGGAGGAAGG + Intergenic
925905942 2:8539749-8539771 TTGGGGATGAGACAGGAGGCTGG - Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926104907 2:10143985-10144007 GTGGAGACGGGAGAGGAGGAAGG - Intronic
927151399 2:20198493-20198515 TGGCAGAAGAGAAAGGAGGCTGG - Intergenic
927156157 2:20222963-20222985 TTGGAGAAGAGAATGGAGCTGGG - Intronic
927198451 2:20564008-20564030 TGGGAGGAGAGCCAGGAGGACGG + Intronic
927247693 2:20971051-20971073 TGGGAGAAGAGAAGGGAGAGTGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927335765 2:21922443-21922465 TTTGATAACAGGAAGGAGGAGGG - Intergenic
927524359 2:23723422-23723444 GAGGAGGAAAGAAAGGAGGAAGG + Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
927908073 2:26876234-26876256 CTGGTGAACAGAATGGAGGAAGG + Intronic
927920239 2:26966739-26966761 TTGGAGATGAGAGAGGCTGAAGG + Intergenic
928308565 2:30191423-30191445 TTGATGACCAGAAAGGAGGAAGG - Intergenic
928667444 2:33564088-33564110 ATGGAGAAAAGAAAGGAGAAAGG - Exonic
928786685 2:34895566-34895588 AGGGAGAAAAGAAAGGAGGGAGG - Intergenic
928933133 2:36645907-36645929 CTGGAGAAGTGAAAGGGAGAAGG + Intronic
929021217 2:37555192-37555214 GCGAAGAAGAGTAAGGAGGAGGG - Intergenic
929290059 2:40180309-40180331 TTAGAGAAGGCACAGGAGGATGG + Intronic
929457812 2:42078382-42078404 GTGGAGGAGAGACAGGAAGAAGG + Intergenic
929591795 2:43152706-43152728 TTGGAGGTGAGAGGGGAGGAGGG - Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929611769 2:43276069-43276091 TCAGAGCAGGGAAAGGAGGAAGG + Intronic
929681681 2:43998247-43998269 TAGGAGTAGAGGAAGGAGCAGGG + Intergenic
929748344 2:44683158-44683180 TTGGAGCATGGAAAGGAGGCAGG + Intronic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930047153 2:47182791-47182813 ATGGAGAAGAGAAAGAAGATGGG - Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930707719 2:54520981-54521003 TTTAGGAAGAGAAGGGAGGAAGG - Intronic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
931152645 2:59592110-59592132 GTGGAGAAGAGAAAGAAGAAAGG + Intergenic
931291224 2:60875710-60875732 CTGGTGAAAAGAAAGGGGGAAGG - Intergenic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931878958 2:66546289-66546311 TAGGAAAACAGAAAGAAGGATGG + Intronic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
932436099 2:71703322-71703344 GAGGAGGAGAGAAGGGAGGAGGG + Intergenic
932512396 2:72307043-72307065 GTGGAGGAGAGATAGGAAGAAGG - Intronic
932724957 2:74171369-74171391 TTTGATAAGTTAAAGGAGGATGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933148964 2:78891349-78891371 TTGAAGGAGAGACAGAAGGAAGG - Intergenic
933214882 2:79618609-79618631 TTGGAGAAGAAAAACAAGAATGG - Intronic
933267281 2:80195211-80195233 TTGGAGTACAGAAAAGAGGCAGG - Intronic
933320612 2:80771452-80771474 TGGAAGAAAAGAAAGAAGGAAGG - Intergenic
933582834 2:84146844-84146866 TTCTAGAAGACAAAGGAGCATGG + Intergenic
933637286 2:84721908-84721930 TGGGGGAAGAGAGAGGAGGCAGG + Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934088007 2:88526222-88526244 CTGGAGTAGAGAAGGCAGGAAGG + Intronic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
934982541 2:98856283-98856305 TTGGAGACCAGAAAGCAGTAGGG + Intronic
935259421 2:101342123-101342145 TGAGAGGAGAGAAAGGAGGTTGG + Intergenic
935431341 2:102979358-102979380 TGGAGGAAGAGAAAGAAGGAAGG - Intergenic
935516675 2:104048941-104048963 GCGGGGAAGAGAAGGGAGGAAGG - Intergenic
935548177 2:104423099-104423121 TGTGAGAAGAGAAAAGATGATGG - Intergenic
935598897 2:104902070-104902092 TTGGAGGAGAGAAAGAGGGAGGG - Intergenic
935850823 2:107216985-107217007 CTGGCAAAGAGAAAGGAAGATGG - Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936501668 2:113071776-113071798 TGAGAGAAGAGAAAGGAAGAAGG - Intronic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937001340 2:118470453-118470475 TCAGAGAAGAGACAGAAGGAGGG - Intergenic
937018288 2:118627210-118627232 GAGGAGAAGAGACAGGGGGAAGG - Intergenic
937129293 2:119495362-119495384 TTGGACAGGAGAGTGGAGGAGGG + Intronic
937232391 2:120405779-120405801 TTGGAGATGGCAAAGGATGAGGG - Intergenic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
937519216 2:122691192-122691214 TTGTGGAAGAGTAAGGAGGCCGG + Intergenic
937535059 2:122876100-122876122 ATGGAGAAGATAGAGGAGGGTGG - Intergenic
937785175 2:125887464-125887486 TTGGGGAAGAGAAGGCAGGGTGG + Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
938149747 2:128871965-128871987 TCTGACTAGAGAAAGGAGGAGGG - Intergenic
938193517 2:129304138-129304160 TTTGAGTAGAGAAAGCAGGAGGG - Intergenic
938516071 2:132009205-132009227 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
938519105 2:132048521-132048543 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
938640207 2:133269765-133269787 TAGGAGCAGAGAAGGGAGCAGGG + Intronic
938757897 2:134397491-134397513 CTGGAGGAGAGAAAGGAGGTGGG + Intronic
938782146 2:134594188-134594210 TTATAAAACAGAAAGGAGGATGG + Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
938919387 2:135980835-135980857 TTGGAGAAGAAAAAGGGTAATGG + Intronic
939131692 2:138242979-138243001 TTGGCAAAGAGAAGGGAAGATGG + Intergenic
939348822 2:141004924-141004946 GTGGTGAAGAGCAAGGAGGGAGG - Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939596907 2:144136442-144136464 AAGGAAAGGAGAAAGGAGGAAGG + Intronic
939623229 2:144446325-144446347 AGGGAGAAAAGAAGGGAGGAAGG - Intronic
940059783 2:149552278-149552300 TGGGAGGGGAGAAAGGGGGATGG - Intergenic
940275127 2:151932074-151932096 TTGGAGAAGATAAAAATGGAAGG + Intronic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940886534 2:158994511-158994533 TTGGGGAAGCCAAGGGAGGAAGG - Intronic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941052805 2:160754053-160754075 TTGGCATAGAGAAAGGAGAATGG - Intergenic
941108317 2:161388530-161388552 TTGCAGAAGGCAAAAGAGGAAGG - Intronic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941465004 2:165815070-165815092 TTGGGGCAGACAGAGGAGGATGG - Intergenic
941705064 2:168649738-168649760 GGAGGGAAGAGAAAGGAGGATGG - Intronic
941812223 2:169766608-169766630 TTGGGGAAGAGAAAAGCAGAAGG - Intronic
941959733 2:171241746-171241768 TAGTAGAAGAGAAAAAAGGAGGG - Intergenic
942173334 2:173308321-173308343 TTGGAGAAGAGATTGGTGGGGGG + Intergenic
942300560 2:174557243-174557265 TGGGGGAAGACAAAGGAGAAGGG + Intergenic
942350253 2:175045195-175045217 TGGGAGGAGAGAAAGGAGGAGGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942999351 2:182305130-182305152 TTGGAGAAGAGAGACAAGGAAGG - Intronic
943330749 2:186556248-186556270 AAGGAGAAAAGAAAGAAGGAAGG - Intergenic
943498744 2:188659233-188659255 TTTGAGAAAAGAGAGGAGGTTGG + Intergenic
943647873 2:190427247-190427269 TCAGAGAAGATAAAGGAGCAAGG - Intronic
943725696 2:191249219-191249241 TTTAAGAAGAGAAATAAGGAGGG + Intronic
943786549 2:191883888-191883910 TTTGAGAATAGAATGAAGGAAGG - Intergenic
944128959 2:196325200-196325222 AGGGAGGAAAGAAAGGAGGAAGG + Intronic
944678482 2:202054294-202054316 AGGGAAAAGAGAAAGAAGGAAGG + Intergenic
944777148 2:202978338-202978360 TGGGAGATGAGGAAGGAGTAGGG + Intronic
945018653 2:205548378-205548400 TTGGAGTAGAGGTGGGAGGAGGG - Intronic
945023583 2:205598284-205598306 ATGGAAAACAGAAAGGAGCAGGG + Intronic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945121169 2:206458766-206458788 TTGGGGAAAAGAGAGGAGGTGGG - Intronic
945155842 2:206836293-206836315 GTGCAGAAGGGAAAGAAGGAAGG + Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945472486 2:210242800-210242822 TTAGGGATGAGCAAGGAGGAGGG - Intergenic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945816347 2:214609511-214609533 TTGCAGAAGAGGAGGGAGCAGGG - Intergenic
945889028 2:215408936-215408958 TTGGAAAAATGAAAGGAAGAAGG - Intronic
945925768 2:215802438-215802460 TTGAAAAAGACAAAGTAGGAGGG + Intergenic
945950465 2:216034532-216034554 GTGAAGGAGAGAGAGGAGGAAGG - Intronic
946076687 2:217079465-217079487 ATGGAGAAAAGAAAGGAGTGGGG + Intergenic
946100518 2:217316360-217316382 TTAGACATGAGAAAGCAGGAAGG + Intronic
946353242 2:219169121-219169143 ATGGAGAAGAGAAGGGTGAATGG + Intronic
946410352 2:219512506-219512528 AAGGAGAAGAGAGAGAAGGATGG + Intergenic
946449133 2:219764630-219764652 GTGGAGAAGAGAAGGAAGTAAGG - Intergenic
946537501 2:220647445-220647467 TTGGACAAGAGCCAGGAGGATGG + Intergenic
946735498 2:222750438-222750460 ATGAAGCAGAGAATGGAGGAAGG + Intergenic
946963185 2:225006694-225006716 TTGGAGAAATAAAAGGAGCAAGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947282748 2:228473650-228473672 TTGGTAAAGAGAAGGGAAGATGG + Intergenic
947502606 2:230682399-230682421 TTAAAGAAAAGAAAGAAGGAAGG + Intergenic
947590177 2:231380936-231380958 GTGGAGAAGAGAGTGGTGGACGG - Intergenic
947590249 2:231381246-231381268 GTGGAGGAGAGAGTGGAGGATGG - Intergenic
947590306 2:231381450-231381472 GTGGAGGAGAGAGTGGAGGAGGG - Intergenic
947590357 2:231381692-231381714 GTGGAGGAGAGAGTGGAGGATGG - Intergenic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948041584 2:234905686-234905708 AGGGAAAAGAGAAAGGAAGAAGG + Intergenic
948091818 2:235301830-235301852 AGGATGAAGAGAAAGGAGGAGGG - Intergenic
948295682 2:236858557-236858579 TTGGTGAAGACAAAAGGGGAGGG + Intergenic
948858800 2:240743083-240743105 TTGGAGAAGAGAGGGTGGGAGGG - Intronic
1168942689 20:1726932-1726954 TTGCTGAAGAGAAAAGAAGAGGG + Intergenic
1169001627 20:2171994-2172016 AGAGAGAAGAGAAAGAAGGAAGG + Intronic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169010671 20:2247498-2247520 TTTGAGAAAAGGAAGGATGAAGG - Intergenic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169233780 20:3912133-3912155 TTGGAGAAGGGAAAGGGAGGAGG + Intronic
1169698182 20:8415540-8415562 GTGAAGCAGAGAAAGGAGAAAGG + Intronic
1169744712 20:8931934-8931956 CTGGAAAAGAGAAGGGTGGATGG - Intronic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1169975608 20:11323817-11323839 TTGGAAAATAGAAAGTAAGATGG + Intergenic
1170020663 20:11833864-11833886 AAGAAGAAAAGAAAGGAGGAAGG + Intergenic
1170075013 20:12409929-12409951 ATACAGAAGAGAAAGCAGGAAGG - Intergenic
1170096324 20:12649622-12649644 ATGAAGAAAGGAAAGGAGGAGGG + Intergenic
1170867693 20:20174666-20174688 GTGGAGGAGAGAAAGGAGGGTGG + Intronic
1171173922 20:23037069-23037091 TTGTACAGGAGAGAGGAGGAAGG + Intergenic
1171726595 20:28627293-28627315 TTGGAGAAGAGCATGCAGGCTGG + Intergenic
1171751661 20:29057320-29057342 TTGGAGAAGAGCATGCAGGCTGG - Intergenic
1172187138 20:33038000-33038022 TTGGACAAAAGGAAGGTGGATGG - Intronic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1172366335 20:34352699-34352721 TGGGAAAAGAGCAAGGAGGAAGG + Intergenic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172898321 20:38316191-38316213 GAGGGGAAGAGAAAGAAGGAAGG - Intronic
1172974464 20:38895793-38895815 AGGGAGGAGAGAAAGAAGGAAGG - Intronic
1172974470 20:38895820-38895842 AGGGAGGAGAGAAAGAAGGAAGG - Intronic
1172974515 20:38895982-38896004 AGGGAGGAGAGAAAGAAGGAAGG - Intronic
1173418491 20:42879918-42879940 TTAGAAAAAACAAAGGAGGAAGG - Intronic
1173427372 20:42954874-42954896 GGAGAGAAGGGAAAGGAGGAGGG + Intronic
1173465341 20:43276450-43276472 ATGGAGAACAGATTGGAGGAAGG + Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173590194 20:44219157-44219179 TAGGAGGAGGGAAAGGAGAAAGG - Intergenic
1174004305 20:47398255-47398277 AAGGAGAAGGGAAAGGAAGAGGG + Intergenic
1174041096 20:47700009-47700031 TGGGAAAAGAGAAAGAGGGATGG + Intronic
1174166098 20:48584562-48584584 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1174406350 20:50305611-50305633 TTGGAAAGAGGAAAGGAGGAGGG + Intergenic
1174436533 20:50510804-50510826 CTGGAGAACAGAAGGGAGGTGGG - Intronic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174727969 20:52884371-52884393 TAGGAAAAGAGAAAAAAGGAAGG - Intergenic
1175055245 20:56191978-56192000 TTGAAGAAGAGAGAAGAGAAAGG - Intergenic
1175062786 20:56258927-56258949 GTGGAGAGAAGAAATGAGGAGGG + Intergenic
1175072259 20:56344388-56344410 TTGGGGAAGTTAAGGGAGGATGG - Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175921336 20:62451808-62451830 ATGGAGAAGAGAGAGGGAGAGGG + Intergenic
1176585912 21:8584977-8584999 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1176657310 21:9598776-9598798 ATGGAGTAGAGAAAGAGGGAAGG + Intergenic
1176742610 21:10617664-10617686 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1176993503 21:15526195-15526217 TTGGTGATGAGAAAGGAGAAAGG - Intergenic
1176998245 21:15580809-15580831 TTGGGGAAGAGATATGTGGATGG + Intergenic
1176998257 21:15580897-15580919 TTGGGGAAGAGATATGTGGATGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177815292 21:25969893-25969915 TTAGAGAAGAGAAGAGGGGAGGG + Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1179048329 21:37866798-37866820 GTTGGAAAGAGAAAGGAGGATGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179462423 21:41546357-41546379 TAGAAGAAAGGAAAGGAGGAAGG + Intergenic
1179470100 21:41604751-41604773 GAGGAGACGAGAAAGAAGGAAGG - Intergenic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180268719 22:10561882-10561904 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1180525486 22:16255136-16255158 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180936611 22:19629641-19629663 CTGGAGAGGAGAATGGAGGCTGG + Intergenic
1181018707 22:20086826-20086848 GTGGAGAAGAGAAAGATGTAAGG + Intronic
1181083138 22:20427101-20427123 TGGCAGAGGAGACAGGAGGAAGG - Intronic
1181774476 22:25149561-25149583 TTGGGGAGGGGCAAGGAGGAAGG - Intronic
1181794906 22:25300431-25300453 TTGGAGAAGAGATATATGGAGGG + Intergenic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181934180 22:26427860-26427882 TTCTAGAAGAGAGAGGAGGTGGG + Intergenic
1181970699 22:26687583-26687605 TGAGAGAGGAGAAAGGATGAGGG + Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182126119 22:27816961-27816983 TTAGAGAAAAGAAGGAAGGAAGG - Intergenic
1182303659 22:29353156-29353178 TTCCAGAACAGAGAGGAGGAAGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182505293 22:30777883-30777905 TTGGAGGAGAGGGAGGAAGAAGG + Intronic
1182925499 22:34119903-34119925 CAGGAGAAGAGAAAGCATGATGG - Intergenic
1183153157 22:36053736-36053758 AGGGAGAAGGGAAAGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183543476 22:38443277-38443299 GGGGAGAAGAGAAGGGAGGTGGG - Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183627240 22:39012019-39012041 TTGCAGTTGAGATAGGAGGAAGG - Intergenic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1184090409 22:42290213-42290235 TGGGAGAAGAGACAGGATGAAGG - Intronic
1184689822 22:46112470-46112492 GAGGAAGAGAGAAAGGAGGAGGG - Intronic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1185154600 22:49185628-49185650 TTAGAGAAGAGAAGGATGGATGG - Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1203290025 22_KI270735v1_random:27761-27783 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1203322881 22_KI270737v1_random:85785-85807 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
949238720 3:1843434-1843456 TTTGTGATGGGAAAGGAGGATGG - Intergenic
949381704 3:3454113-3454135 TTTTAGAAGAGAACTGAGGAAGG + Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949642083 3:6047984-6048006 CTGGCAAAGAGAAAGGAAGAGGG - Intergenic
949722445 3:7006086-7006108 TTGGAGGAGAGCCAGGAGGGGGG - Intronic
949910009 3:8895747-8895769 TTGGAGATGAGAAAACAGGTTGG - Intronic
950014124 3:9744201-9744223 CTGGAGCAGAGAAAGAAAGAAGG - Intronic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
951008453 3:17647420-17647442 TTGGCGTAGGGAAAGGAGCAAGG + Intronic
951139078 3:19140356-19140378 TGGAAGAAAAGAAAGTAGGATGG + Intergenic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
952501149 3:33963249-33963271 TACGAGAATAGAAAGGAAGAAGG - Intergenic
952519264 3:34139083-34139105 GTGGAGAGGAGAAAGGCAGAAGG - Intergenic
952681240 3:36095843-36095865 TGGGAGTAGAGAAAGTGGGATGG - Intergenic
953147198 3:40289756-40289778 TGGGAAATAAGAAAGGAGGAGGG + Intergenic
953183358 3:40616511-40616533 GGGGAGCAGATAAAGGAGGACGG + Intergenic
953192306 3:40699472-40699494 TGAGAGAAGAGAAGGGATGAAGG - Intergenic
953198679 3:40756968-40756990 GTGGAGCAGAGCAGGGAGGAGGG + Intergenic
953205274 3:40822288-40822310 TTGGAGAGGAGATAAGAGGGTGG + Intergenic
953474224 3:43192440-43192462 GGCGAGAAGAGAAAGGAGCAGGG + Intergenic
953533397 3:43758146-43758168 ATGCAGAAAAGAAAGGAGAATGG - Intergenic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954464596 3:50647039-50647061 TGGGAGAAGAGGATGGAGTAGGG + Intronic
954918692 3:54170644-54170666 TTGCTGAACTGAAAGGAGGAAGG - Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955005374 3:54963833-54963855 TGGGAGAAAGGAATGGAGGAAGG + Intronic
955045588 3:55356977-55356999 ATGGTGAAGAGAAGGGAGTATGG - Intergenic
955094209 3:55781522-55781544 TGGGAGAAGAAAAGGGAGCAAGG - Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955565944 3:60246352-60246374 TGGCAGAAGAGAAAAGGGGAAGG + Intronic
956502754 3:69904554-69904576 TTGGAGGAGAGAGAGGTAGAGGG - Intronic
956788000 3:72658500-72658522 TAGGAGAAGAGGAAGGTGAATGG - Intergenic
956974191 3:74561255-74561277 GAGGAGAATAGCAAGGAGGATGG - Intergenic
957084448 3:75667696-75667718 TTGGAAAGGAGAAAGTAGGGAGG + Intergenic
957139724 3:76337612-76337634 TGGAAGAAGAGAAAGGAGTCAGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957320869 3:78628504-78628526 TGGGATAAGAGAAAAGAGAAAGG - Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957338543 3:78862883-78862905 TTGGAGTAGAGAAAGTATGGAGG - Intronic
957841157 3:85671598-85671620 TTAGAGAAGGGGAAGGAGAAGGG - Intronic
957900485 3:86482532-86482554 ATGAAGAAGAGAAAGCATGAAGG - Intergenic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
958934393 3:100241242-100241264 TTGGGGAAGAGATATGTGGATGG + Intergenic
958965947 3:100558398-100558420 TTGTAGAAGATAAAGGCTGATGG - Exonic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959725546 3:109537955-109537977 TTGAAGAAAAGAAAGAAGAAAGG + Intergenic
959802797 3:110515502-110515524 TCTGGGAAGGGAAAGGAGGAAGG - Intergenic
959817908 3:110697599-110697621 TTAGAAAAGAGAAAGAAGAATGG + Intergenic
959868726 3:111302267-111302289 TGGGAGGAGAGAGTGGAGGAGGG + Intronic
960185648 3:114634918-114634940 TAGGAGCAAAGAAATGAGGAGGG + Intronic
960198082 3:114795543-114795565 TTGGGGTAGAGAACGGAGTATGG - Intronic
960208418 3:114930993-114931015 GTGGAGAAAAGAACGAAGGACGG + Intronic
960235863 3:115281296-115281318 TTGGAACAGGGAAAGGAGGATGG - Intergenic
960246784 3:115408522-115408544 ATGGAAAAAAGAAAGAAGGATGG + Intergenic
960349556 3:116575964-116575986 TTGGGGAAGAGAAGGCAGGGTGG - Intronic
960423296 3:117475618-117475640 TTAGAGAACAGAAAGAAAGATGG - Intergenic
960428067 3:117533571-117533593 CTAGAGAACAGAAAGGAGGTAGG - Intergenic
960513836 3:118581079-118581101 GAGGAGAAGAGAGAGAAGGATGG - Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961110283 3:124277694-124277716 GTGGAGAACAGAATGGAGGAAGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961345475 3:126260747-126260769 TGGGAGAAGAACAGGGAGGAAGG - Intergenic
961368309 3:126415080-126415102 TTGGAGAAGATACAGTAGGGTGG - Intronic
962148015 3:132861615-132861637 ATGGAGAAGAGTAAGGCAGAAGG + Intergenic
962221608 3:133569062-133569084 CTGGAGAGTAGAAAAGAGGAAGG - Intergenic
962467589 3:135674644-135674666 TTGGAGAAGAGAAAGGGGAGGGG - Intergenic
962551107 3:136492996-136493018 GGGGAGTTGAGAAAGGAGGAAGG + Intronic
962658078 3:137569802-137569824 TGGTAGAAGAGAGAGGAGGAAGG - Intergenic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
962932950 3:140054214-140054236 GTGGAGAATAGCAAGGAGGCTGG + Intronic
962962876 3:140327507-140327529 TTTGAGGAGAGATATGAGGAAGG - Intronic
963249523 3:143090290-143090312 ATGGAAAAGAGAAAGAAAGAGGG - Intergenic
963871050 3:150413924-150413946 TTTGAGAAAAGAAAGGAAAATGG + Intronic
963941850 3:151103738-151103760 TCGCAGAAGAGAAAGGGAGATGG + Intronic
964041466 3:152267216-152267238 GTGGAGAAGAGAAAAGAGCAGGG - Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964205555 3:154171010-154171032 TTGGAGAAGAGAAATGGGAGAGG + Intronic
964557174 3:157952469-157952491 AGGAAGAAGAGAAAGAAGGAAGG - Intergenic
965189580 3:165511221-165511243 TTGGGGAAGAGTAAAAAGGAAGG - Intergenic
965602700 3:170470673-170470695 TTGGAGAAAAGAAAAATGGAGGG + Intronic
965757710 3:172041441-172041463 GAGGAGAAGAGAAGGAAGGAAGG - Intronic
966024777 3:175263747-175263769 ATGAAGAAAAGAAGGGAGGAAGG + Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966159065 3:176949074-176949096 TAGAAGAAGAGAAAGGAGTTTGG - Intergenic
966178424 3:177165021-177165043 TTAGATACGAGAAAGAAGGAAGG - Intronic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966299982 3:178467837-178467859 ATGGAAAAGAGAAAGGGGGCAGG + Intronic
967104159 3:186242108-186242130 TTGGGGAAGAGCAGGGAGGCTGG - Intronic
967266725 3:187698201-187698223 GTGGAGGAGAGAAAGGAAGCAGG + Intergenic
967278131 3:187796342-187796364 TTGGAGAAGAGAGAGAACAAAGG + Intergenic
967354728 3:188555694-188555716 GTTTAGAAGAGAAAGGAGAAAGG + Intronic
967831813 3:193926253-193926275 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
968165775 3:196464070-196464092 GTGGAGAAGAGCCAGAAGGAAGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968672132 4:1857300-1857322 TTGGGGCAGAGAAAGCAGGCAGG + Intergenic
968677890 4:1894933-1894955 TGGGGGAAGAAAAAGGAGGATGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969243186 4:5915405-5915427 TAGGAGATGACAAAGGAGAAAGG - Intronic
969278320 4:6152034-6152056 TTGGAAAGGAGAAAGGAAGCAGG + Intronic
969338530 4:6526538-6526560 TTGGTGAAAAGAAAAGAAGAGGG + Intronic
969454729 4:7294735-7294757 GGGGAGAAGAGAGAGGATGAGGG - Intronic
969470729 4:7385976-7385998 TTGGAGGCCAGAAAGGAGGGAGG + Intronic
969668671 4:8577033-8577055 GCGGAAAAGAGAAAGGAGGAAGG - Intronic
969724357 4:8910598-8910620 CTGGAGAAGAGAAGGGTGAAGGG - Intergenic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970103946 4:12558948-12558970 GTGGAGTAGAGCAAGGAGAAGGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970322047 4:14884503-14884525 ATGGAGAATAGATTGGAGGATGG - Intergenic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
970522458 4:16899361-16899383 TTGGAGAAGAGGGAGGTGGCTGG - Intergenic
970616285 4:17771261-17771283 GTGGAGAAAGGATAGGAGGAAGG + Intronic
970760141 4:19475832-19475854 TTGAAAAACAGCAAGGAGGACGG + Intergenic
970808206 4:20060880-20060902 TTAGATAAGACAGAGGAGGAAGG + Intergenic
970810781 4:20091621-20091643 GGGGAGAAAAGAAAGAAGGAAGG + Intergenic
970867245 4:20773288-20773310 TAGGAGAAGGCAAAGGAGGGTGG - Intronic
970938346 4:21601497-21601519 TAGGGGAAGAGAAAGGGGAAAGG - Intronic
971312380 4:25536579-25536601 TGGGAGAGGAGATAAGAGGAGGG - Intergenic
971355165 4:25888665-25888687 TAGGAGAGGAGAAGGGAGGGGGG - Intronic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971799105 4:31265727-31265749 TCGGAGAGGAGAAGGGAGAAAGG + Intergenic
971799130 4:31265957-31265979 ATGTAGGAGAGAAGGGAGGAAGG + Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
971804580 4:31339272-31339294 TGGGAGTACACAAAGGAGGAGGG - Intergenic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972685387 4:41347818-41347840 GTGAAGAAGAGAAGGAAGGAAGG - Intergenic
972796938 4:42430608-42430630 TGGGAGAAGAGAGAGGATCAGGG - Intronic
973090157 4:46125408-46125430 TGGGAGAAGAAAAACAAGGAGGG - Intergenic
973124445 4:46566917-46566939 AAGAAGAAGAGAAGGGAGGAAGG + Intergenic
973252864 4:48078909-48078931 TTGAAAGAGAGAAAGGTGGAAGG + Intronic
973260506 4:48158953-48158975 TTGAAAGACAGAAAGGAGGAAGG + Intronic
973569818 4:52226584-52226606 TTGGAGGAAAGAAAAGAGAAGGG + Intergenic
973740396 4:53914193-53914215 TTTGAGGGGAGAAAGAAGGAAGG - Intronic
973927752 4:55757044-55757066 TTGGCTAAATGAAAGGAGGAGGG - Intergenic
974075176 4:57162044-57162066 TTGCAGAAGAGCATGTAGGATGG + Intergenic
974283098 4:59824750-59824772 CTGGAGAAAAGAAAGGAGGGTGG - Intergenic
974432323 4:61815420-61815442 TTGGAGAAGAGATTGGCAGAAGG + Intronic
975318725 4:72984976-72984998 TTAGAGAGGAGAAAGGTGAAGGG - Intergenic
975591985 4:76010217-76010239 TTCCAGCAAAGAAAGGAGGATGG + Intergenic
975755176 4:77564823-77564845 GTGGAGAAGTGAAAAGAGAAAGG + Intronic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
975969416 4:80015788-80015810 TGGGAGAGAAGAAAGAAGGAAGG + Intronic
976017020 4:80568692-80568714 ATGGAGAGGAGAAAGAAGAAAGG + Intronic
976090656 4:81453833-81453855 ATAGAGATGAGAAAGGAGCAAGG + Intronic
976350880 4:84058685-84058707 TGGGAGTAGAGAGGGGAGGAAGG - Intergenic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976766541 4:88603827-88603849 TTCTACAACAGAAAGGAGGAGGG - Intronic
977221643 4:94344632-94344654 TGGGAGAAGAGACAAGAGGATGG - Intergenic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978449785 4:108819738-108819760 TGGGAGAAGAGCAAGCCGGAGGG - Intronic
978472782 4:109088802-109088824 TTGGACAAGAGAATGAATGATGG + Intronic
978499960 4:109399071-109399093 GAGGAGAAGAGAAAGAGGGAGGG + Intergenic
978508094 4:109482741-109482763 TGGGAGTTGAGACAGGAGGATGG - Intronic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
979438090 4:120718901-120718923 TTGCAGAAGAGAAAGTTTGAGGG - Intronic
979458942 4:120958051-120958073 TTGGAAAAGAGAAATGGAGAGGG - Intergenic
979615027 4:122732863-122732885 TAGGAGAGGAGAAAGGAGCGAGG + Exonic
979778905 4:124624806-124624828 TGAGAGAAGAGAAGGGAGGAGGG - Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
979999280 4:127469823-127469845 TTTGAGAAAAGAAAGGAGGAAGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980065036 4:128178149-128178171 TCTGAGAAGGGAAAGCAGGAGGG + Intronic
980287679 4:130801957-130801979 TTCCAAAAGATAAAGGAGGAAGG - Intergenic
980629605 4:135414921-135414943 TTGGGGAAGAGTTATGAGGATGG + Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
980889024 4:138794354-138794376 TGGGAGAAGAGAGAGGTGGTGGG + Intergenic
980999420 4:139814283-139814305 TTGGAGAGCAGAAATCAGGATGG + Intronic
981116396 4:140995652-140995674 ATGGAGATGAGATAGGAGGCGGG - Intronic
981156237 4:141440131-141440153 TTGGAGATGAGAAAGATGAAAGG - Intergenic
981438126 4:144750128-144750150 TTGGGGAAGGGAGAGGGGGAAGG + Intergenic
981950707 4:150403549-150403571 AAGGAGAAGGGAAAGGAGAAGGG - Intronic
982010630 4:151102626-151102648 ATGGAGGGTAGAAAGGAGGAGGG + Intronic
982025387 4:151248669-151248691 TTGGAGAAGTGGAAGGCGCATGG + Intronic
982261487 4:153498126-153498148 TGGGAGAAGATGTAGGAGGATGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982738870 4:159037014-159037036 GCTGAGAAGAGAAAGGAAGAAGG + Intronic
982782410 4:159505103-159505125 TTGGAGAAGGGAAAGAAGGGAGG - Intergenic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
983775090 4:171596573-171596595 TTCAAGGAGAGAAAGGGGGATGG + Intergenic
984011776 4:174380489-174380511 TTGCAGTTGAGATAGGAGGAAGG + Intergenic
984331226 4:178321646-178321668 TTGAAGGAGAGATGGGAGGAAGG - Intergenic
984388758 4:179100070-179100092 TGGGAGAAGGAAAGGGAGGAAGG + Intergenic
984443255 4:179800301-179800323 TTAGAAAAGAGAAAGTAGGCTGG + Intergenic
984617558 4:181915695-181915717 GGGGAGGAGAGAAAAGAGGAGGG + Intergenic
984703717 4:182833812-182833834 GGGGAGAGGAGAAGGGAGGAGGG - Intergenic
984703945 4:182834458-182834480 GGGGAGAGGAGAAGGGAGGAGGG - Intergenic
985147788 4:186912061-186912083 TTGCAGAAGAGAAAAAAGGAAGG - Intergenic
985434053 4:189911644-189911666 TTGGAGAAGAGCATGTAGGCCGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
985851570 5:2392418-2392440 AGGGAGGAGAGAAAGAAGGAAGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985958063 5:3279046-3279068 TGGGAGGAGAGGAAGGAGGGAGG - Intergenic
986217133 5:5729955-5729977 TTGGAGAAGAGAAGGGTACAGGG - Intergenic
986372820 5:7097834-7097856 TTGGAGGAGAGAGAAGAGGGGGG + Intergenic
986678401 5:10210878-10210900 TTTAAAAAGAGAAAGGAAGAAGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987646012 5:20672973-20672995 GTGGAGAAGAGAAAGCTGCAAGG - Intergenic
987712144 5:21514208-21514230 GTGGGGAAGAGACTGGAGGAAGG - Intergenic
987977263 5:25030419-25030441 TTTGAGATGAGAAAGGAAGCAGG + Intergenic
988082485 5:26431460-26431482 TGGGAAAAGAGAAAGGGAGAAGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988302265 5:29446580-29446602 GTGGGGAAGAGATTGGAGGAAGG + Intergenic
988528743 5:32008991-32009013 TTGGTGGGGAGACAGGAGGAGGG + Intronic
988653841 5:33184830-33184852 ATGAAAAAGAGAAAGCAGGAAGG - Intergenic
988901852 5:35741426-35741448 TTGAAGAACAGCAAGGAGGCTGG + Intronic
988942435 5:36159741-36159763 GTGGAGAAGACAGAGGTGGAAGG - Intronic
988984117 5:36600178-36600200 TTAGGGAAGAGAGAGGAGGAGGG + Intergenic
989122893 5:38021741-38021763 AAGGAGAATAGAAAGGAAGAAGG - Intergenic
989183870 5:38604271-38604293 GTGGAGAGGAGAAAGGGGCAAGG + Intronic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
989357147 5:40556340-40556362 TTGGAGAAAAGAAGGGTAGAAGG - Intergenic
989360639 5:40597731-40597753 TTGCAGAGGAGAAAAGAGCAAGG + Intergenic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
989559931 5:42838395-42838417 GTGGAGAAGTGAAAGGATGGTGG + Intronic
989746048 5:44830930-44830952 TAGGAGAAGAGAAGGGAAGTTGG + Intergenic
990081016 5:51913705-51913727 CTGGTGGAGAGAAAGGAAGAGGG + Intergenic
990448002 5:55910791-55910813 TTGGTGAACAGAGAGCAGGATGG - Intronic
990489902 5:56294479-56294501 TTGTGGAAGAGAAAGGAGTTGGG + Intergenic
990516916 5:56539023-56539045 TTGATGATGAGAAAGGATGAAGG + Intronic
990521476 5:56585625-56585647 TTGGAGCTGAGAGAGGAGAAAGG - Intronic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990618934 5:57539047-57539069 TGAAAGAAGAGAAAGGAGGAAGG + Intergenic
990642795 5:57806709-57806731 CTGGAGAAAAGAAAGGCAGAAGG + Intergenic
991024370 5:62014203-62014225 TTGGAGGAGGGAAGGAAGGAAGG - Intergenic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
991106125 5:62843991-62844013 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
991448604 5:66727502-66727524 GTGGAGGGGAGAGAGGAGGAGGG + Intronic
991460129 5:66849393-66849415 GGGGAGAATAGACAGGAGGAGGG - Intronic
991557668 5:67913946-67913968 TAAGAGAACAGGAAGGAGGAAGG + Intergenic
991762506 5:69933344-69933366 GTGGGGAAGAGACTGGAGGAAGG - Intergenic
991784819 5:70184762-70184784 GTGGGGAAGAGACTGGAGGAAGG + Intergenic
991841734 5:70808394-70808416 GTGGGGAAGAGACTGGAGGAAGG - Intergenic
991877266 5:71185155-71185177 GTGGGGAAGAGACTGGAGGAAGG + Intergenic
991963713 5:72070694-72070716 CTGGAGAATAGCAAGGAGCAGGG + Intergenic
992140516 5:73792329-73792351 TTTGAGAAGGGAAAGGAAGCTGG + Intronic
992417613 5:76566821-76566843 TGGGAGATGACCAAGGAGGAGGG + Intronic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992813985 5:80418221-80418243 GAGGAGAAGAGAAAGGAGAGAGG - Intronic
992924180 5:81564273-81564295 TTGCACAAGAGAATGGAGAAAGG + Intronic
992942178 5:81773333-81773355 TTGGAGAAGAGAGAATAAGAGGG - Intergenic
993032265 5:82718331-82718353 AAGGAGAAAAGAAAGAAGGAGGG + Intergenic
993203479 5:84848171-84848193 TTGGGGAAGAGATATGTGGATGG + Intergenic
993231825 5:85246909-85246931 TTGGTGAAGAGATATGTGGATGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993791865 5:92219538-92219560 TTGGAGAAGAGTTATGTGGATGG + Intergenic
994187467 5:96831196-96831218 CAGGAGAAGAGAGAGGAGGGAGG + Intronic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994591736 5:101782761-101782783 TTGGGGCAGAGAAAATAGGAAGG + Intergenic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
994973210 5:106770220-106770242 TGGAAGAGGAGAAAGGAGGCAGG - Intergenic
995041766 5:107596014-107596036 TTTGACAAGAAATAGGAGGAAGG - Intronic
995106020 5:108379719-108379741 TGGGAGAAGAGAGAAAAGGAGGG + Intronic
995129589 5:108615920-108615942 AGGAAGAAAAGAAAGGAGGAAGG + Intergenic
995458716 5:112379601-112379623 TTGCAGATGAGAAAGCAGGAGGG - Intronic
995544019 5:113212263-113212285 TTGGTGTAGAGAAAGGGGAATGG - Intronic
995838942 5:116424902-116424924 TTGGAGTACAGAAGGGAGGCAGG - Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996167410 5:120242287-120242309 TGGGAGGGAAGAAAGGAGGAAGG - Intergenic
996282793 5:121751675-121751697 TTGCAGAAGAAAAAGGAGAGAGG + Intergenic
996300165 5:121972356-121972378 TTGAAAGAGAGAAAGGAGGACGG + Intronic
996301513 5:121992326-121992348 GGGGAGAAGAGAAAGAAAGAGGG - Intronic
996362507 5:122665665-122665687 TTTCTGAAGAGAAGGGAGGAGGG + Intergenic
996838070 5:127816086-127816108 TTAGAGAAAAGTAATGAGGAGGG + Intergenic
996957294 5:129199484-129199506 TTGGAGAAGTGAAAGGAATCTGG + Intergenic
996988232 5:129594786-129594808 TTGGGGAAGGGAGAAGAGGAGGG - Intronic
997035849 5:130190309-130190331 TTTGAGATCAGAAAGGAAGAGGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997082661 5:130758968-130758990 TTGGTGAAAAGAAAGAAGGTAGG - Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997242788 5:132320304-132320326 TTGGAAAAGAGAAAGGGCGCAGG - Intronic
997261537 5:132469148-132469170 ATGGAGAAGAGAGAGGCAGAAGG + Intronic
997497432 5:134341727-134341749 TTGGCAAAGAGAAGGGAAGATGG - Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
997886696 5:137636980-137637002 TTGGGGAAGGGAAGGGAGTAGGG - Intronic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998435764 5:142107873-142107895 TGGAAGAACAGAAAGGAGGCTGG - Intergenic
998484086 5:142486597-142486619 GAGGAGGAGGGAAAGGAGGAAGG - Intergenic
998524660 5:142831603-142831625 TTGGAGAAGGGAGGGGAGGGTGG - Intronic
998616526 5:143746524-143746546 TTGAATAAGAGAAAGGAATAGGG - Intergenic
998704355 5:144741311-144741333 TAGGAGAAGAAAAGGAAGGATGG - Intergenic
998975863 5:147646036-147646058 TGGGAGAAGAGCAAGGAAAAAGG + Intronic
999073588 5:148773670-148773692 GTGGATAAGAGAAGGGTGGAGGG + Intergenic
999186506 5:149714575-149714597 TTTGTGAAGAAAAAGGAGGTGGG - Intergenic
999481236 5:151950008-151950030 GTGGGGATGAGAAAGAAGGAAGG - Intergenic
999751713 5:154632358-154632380 AGGGAGAAGGGAAAGAAGGAAGG - Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999875636 5:155802797-155802819 TTGGAGAAGAGATGGGAAAAAGG + Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999958508 5:156728261-156728283 TGGGAGGAGAGAGAGGAAGAAGG - Intronic
1000046275 5:157524319-157524341 ATGGAGAACAGAATGGAGAATGG - Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000266343 5:159641574-159641596 AAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1000275560 5:159731749-159731771 TTGGAGAAAAGACAGAAGCAAGG - Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000638184 5:163667693-163667715 GTGGAGAAGAGATGGGAGAAGGG - Intergenic
1000727012 5:164784373-164784395 CTAAAGAAGAGAAAGGGGGAAGG + Intergenic
1000853098 5:166364133-166364155 TTGGAGAAGGGATAGAAGAATGG + Intergenic
1000926228 5:167197955-167197977 GGGGAGAAAAGAAAGGAGAAAGG + Intergenic
1001041908 5:168342225-168342247 TTGGAGCAGAGGAAGGGAGAGGG + Intronic
1001108411 5:168875326-168875348 AGGGAGAAATGAAAGGAGGAAGG + Intronic
1001154453 5:169261152-169261174 TTACAGAAGAGTATGGAGGAAGG + Intronic
1001155951 5:169272636-169272658 TGTGAGAAGAGAAACGAGAAGGG + Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001196627 5:169678920-169678942 ATGGAGAAGAGAAACTCGGAGGG + Intronic
1001241947 5:170077894-170077916 CCGGAGAAGAGAGAGAAGGAGGG - Intronic
1001551150 5:172603050-172603072 TTGGAGAAGACAAAGAAACAGGG + Intergenic
1001593406 5:172881884-172881906 AGGGTGAAGAGAATGGAGGAGGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001767032 5:174257910-174257932 TTGGACAAGAGCAAGGAAGAAGG - Intergenic
1001773578 5:174312707-174312729 ATGGAAAAGAGAAAGAAGGGTGG - Intergenic
1001926107 5:175638405-175638427 TTGCAGGAGAGAAAAGAGGTGGG - Intergenic
1001955662 5:175846674-175846696 TTGGGGAAGAGAAATCAGGCAGG - Intronic
1001972391 5:175967402-175967424 GCGGAGAAGAGAAGGGAGAAAGG - Intronic
1002174375 5:177393280-177393302 TTGGAGGAGAGGAAGGAGCCAGG + Intronic
1002245046 5:177876375-177876397 GCGGAGAAGAGAAGGGAGAAAGG + Intergenic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1002742628 5:181444766-181444788 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1002742662 5:181444887-181444909 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003087828 6:3075330-3075352 TGGAAGAAAAGAAGGGAGGAAGG + Intronic
1003148740 6:3530976-3530998 TTGGTGAAGAGGCAGGAGTATGG + Intergenic
1003335500 6:5168132-5168154 TGGGAGAAGAGAGAGGAAGGAGG + Intronic
1003375456 6:5572679-5572701 GTGGAGAAGAGAAAAGATGGGGG - Intronic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004100804 6:12608996-12609018 CTGGAGAAGAGAAATGGGGTTGG + Intergenic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004365568 6:15009663-15009685 ACGAGGAAGAGAAAGGAGGACGG - Intergenic
1004622948 6:17347264-17347286 TGGGAGATGAGAAGTGAGGATGG - Intergenic
1004636225 6:17470593-17470615 TTGGAAAAGAGAATGCAGGAAGG + Intronic
1004824205 6:19402603-19402625 TTGGGGAAGAGATATGTGGATGG - Intergenic
1004861996 6:19813843-19813865 TTGGAGAAGAGCCACGATGAGGG + Intergenic
1004926123 6:20416708-20416730 TTTGGGAAAAGAAAGGAGTAGGG + Intronic
1005018197 6:21393483-21393505 TGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005321725 6:24662278-24662300 TTGCAGTTGAGAAAAGAGGAAGG + Intronic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1006001584 6:30969341-30969363 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1006274873 6:32995710-32995732 AAGGAGGAGAGAAAGGATGAAGG - Intergenic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006504225 6:34477578-34477600 CTGGAGAAGAGAAAATATGATGG - Intronic
1006505523 6:34486375-34486397 TTGAAGATGAGAAAACAGGAAGG + Intronic
1006638155 6:35474838-35474860 TGGGAGAAGAGAGGAGAGGAGGG - Exonic
1006919000 6:37615369-37615391 TGGGAGGAGGGAAAGGAGTAAGG - Intergenic
1007211112 6:40194053-40194075 TTGTAGCAGGGAAAGGAGGCTGG - Intergenic
1007234993 6:40384202-40384224 TTTGAGAGAAGAAAGGAGGCAGG - Intergenic
1007393238 6:41562539-41562561 TGGAAAAAGAGAAAGAAGGAAGG - Intronic
1007464984 6:42045545-42045567 TTGGGGAAGAGAAAAGTGAAGGG + Intronic
1007635080 6:43294874-43294896 TTGGAGTAGAGATGAGAGGATGG - Intergenic
1007654381 6:43443430-43443452 TCAGAGAAGAGAAAGGAGTCAGG + Intronic
1007778839 6:44239550-44239572 TTGGAGAAGAGAGAGGCTGAAGG - Intergenic
1007806658 6:44455378-44455400 TGGTGGAAGAAAAAGGAGGATGG + Intergenic
1007890809 6:45289414-45289436 TTTGATAAAAGAAAGGTGGATGG - Intronic
1007932924 6:45708693-45708715 TAAGACAAGAGAAAGGCGGAAGG + Intergenic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008079656 6:47180652-47180674 TTGGAGAAGAGTTATGAGAATGG - Intergenic
1008234740 6:49030532-49030554 ATGCAGAAGGGACAGGAGGAAGG + Intergenic
1008461898 6:51785155-51785177 TGGGAGGAGGTAAAGGAGGAAGG + Intronic
1008561048 6:52725044-52725066 TTGGAGAAGAGAAGGCTGGGTGG - Intergenic
1008601631 6:53101717-53101739 TTGGAAAATAGAAAGCAGGTGGG + Intergenic
1008619364 6:53256863-53256885 TTGGAGAAGGGAAAAGAACAAGG + Intergenic
1009005561 6:57782487-57782509 GTGGGGAAGAGACTGGAGGAAGG + Intergenic
1009430275 6:63558291-63558313 ATGGAGGAGAGAAAGAAGCAGGG + Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009530548 6:64808035-64808057 GGGAAGAAGGGAAAGGAGGAAGG - Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009602008 6:65813219-65813241 GGGGAGAGGATAAAGGAGGAGGG + Intergenic
1010015865 6:71104546-71104568 TTAGAGTAGAGAGTGGAGGACGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010323610 6:74540751-74540773 CTGGAGAAGAGAAGGCAGGGTGG - Intergenic
1010434249 6:75811791-75811813 AAGGAAAAGAGAAAGGGGGAGGG + Intronic
1010478333 6:76317734-76317756 AAGGAGAAAAGAAAGGAGAAAGG - Intergenic
1010818713 6:80389036-80389058 TTGGGGAAGAGATATGTGGATGG + Intergenic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1011040393 6:83023727-83023749 TTGGAGAAAAGGCAGGGGGAGGG + Intronic
1011300165 6:85865317-85865339 CAGGAGAAGAGCAAGGAAGAAGG - Intergenic
1011375998 6:86687527-86687549 TTGGAAAAGAGAAAGAATGATGG - Intergenic
1011484683 6:87829635-87829657 TTGAAACAGAGAAGGGAGGAAGG - Intergenic
1011490291 6:87884566-87884588 TTGGAGAAAAGGCAGGATGAAGG + Intergenic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012083623 6:94793600-94793622 TTGGGGAGGGGAAAGGAGAATGG - Intergenic
1012161951 6:95896724-95896746 TTGAAGAAGATAAAGTACGAAGG - Intergenic
1012334962 6:98044182-98044204 ATGAAAAAGAGAAAGGGGGAGGG + Intergenic
1013016543 6:106165019-106165041 TAGAAGAATAGAAAGGGGGATGG + Intergenic
1013300911 6:108804216-108804238 TTGGATAGGTGAAAGGAGGCAGG + Intergenic
1013535098 6:111056718-111056740 TTGTTGAAGAGAAATGTGGATGG - Intergenic
1013646902 6:112152818-112152840 TTAGAAAAGAGGAAGGAGGCAGG - Intronic
1013752468 6:113423227-113423249 TTAGAGGAGACAAAGGAGTATGG - Intergenic
1013757756 6:113481338-113481360 TTGCAGAGAAGAAAGGAGCATGG + Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014443910 6:121504457-121504479 TTAGACAAGACAAAGTAGGAAGG - Intergenic
1014489649 6:122046065-122046087 TTGCAGAAGAAAAAGGAAGCTGG + Intergenic
1014583667 6:123170285-123170307 ATGGTGAAGTGAAAGGAGCATGG + Intergenic
1014776088 6:125511449-125511471 GAGGAGAAGAGAAAGGAGAGGGG - Intergenic
1015226760 6:130865846-130865868 GTGGAGAAAAGAGAGGAGAATGG + Intronic
1015242106 6:131036183-131036205 TAGGCAAAGTGAAAGGAGGAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015466816 6:133557451-133557473 TTGGGGAAGAGAAGGCAGGGTGG + Intergenic
1015475778 6:133657748-133657770 TTGGGGAAGAGAAGGCAGGGTGG - Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015640371 6:135325680-135325702 TAGGGGAAGAGAAAGAAAGAAGG - Intronic
1015809738 6:137149797-137149819 TTGAAGAAGAGCATGCAGGAAGG - Intronic
1015885198 6:137910674-137910696 TGGGAGGAGGGAAAGGAGGAAGG + Intergenic
1016565890 6:145453294-145453316 TTGGTTAAGAGAATGGAGGTGGG + Intergenic
1016701157 6:147055825-147055847 ACAGAGAAGAGAAAGGAGGTAGG - Intergenic
1016757121 6:147698950-147698972 TTGGGCAACAGAAAGGAGGCTGG + Intronic
1016998633 6:149979236-149979258 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1016999757 6:149988574-149988596 AGGGAGAAGGGAGAGGAGGATGG + Intergenic
1017006859 6:150033700-150033722 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1017981728 6:159406695-159406717 TTAGACAAGAGTAAGGAGGAGGG + Intergenic
1018175159 6:161172229-161172251 TGCGAGAAGTGCAAGGAGGAAGG + Intronic
1018414445 6:163589159-163589181 TAACAGAAGAGAAAGGAGTAAGG + Intergenic
1018425340 6:163674912-163674934 TTGGAGATGGGAAAGATGGATGG + Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1019035013 6:169047406-169047428 TTGGAGGTGAAATAGGAGGAGGG + Intergenic
1019247763 6:170720505-170720527 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1019247797 6:170720626-170720648 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1019474897 7:1239676-1239698 TTGGAGATGAGAAATGGAGATGG - Intergenic
1019772854 7:2894774-2894796 GTGGAGGAGAGAGAGGAGAAAGG - Intergenic
1020135501 7:5585833-5585855 GGGGAGAAGAGAAGGGAGGGTGG + Intergenic
1020288653 7:6706184-6706206 CTGGAGCAGAGAGAGGAGGAAGG + Intronic
1020396806 7:7726139-7726161 TTGGGGAAGAGATATGTGGATGG + Intronic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1020690291 7:11346671-11346693 GTGAAGAAGAGAAGAGAGGAGGG - Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1021170258 7:17390958-17390980 TTGCAGTGGGGAAAGGAGGAGGG - Intergenic
1021352965 7:19617704-19617726 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1021502511 7:21346279-21346301 TGGGAAAAGAGAGAGGGGGAGGG + Intergenic
1021817453 7:24461615-24461637 TTGGAGAAGATAATGGTGGCAGG - Intergenic
1021971042 7:25966539-25966561 AAGGAGGAAAGAAAGGAGGAAGG + Intergenic
1022243551 7:28535300-28535322 TAGGAAAAGTGAAAGGAGGGAGG + Intronic
1022374047 7:29796945-29796967 GTGGAGAAGAGTTAGGAGGAGGG + Intergenic
1022903271 7:34831453-34831475 AGGGAGAAAAGAAAGGAGGGGGG + Intronic
1023075475 7:36478019-36478041 ATAGAGAAGAGAAAGAAGGAAGG - Intergenic
1023168180 7:37363662-37363684 GGGGAGAAGTGAAAGGAGGTAGG - Intronic
1023230631 7:38024272-38024294 CTGGAGATGAGTAAGCAGGAGGG + Intronic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1023910079 7:44547691-44547713 AAAGAGAAAAGAAAGGAGGAAGG + Intergenic
1024161907 7:46684707-46684729 ATGGAGAAGAGAAAGAGGAAAGG - Intronic
1024351255 7:48367171-48367193 TAAGAGAAAAGAGAGGAGGAGGG + Intronic
1024377674 7:48657607-48657629 TTGAAGATGAGATAGGAGTAGGG + Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024573925 7:50748435-50748457 TAGGAGTGGAGAAAGGAGGTAGG + Intronic
1024598128 7:50956881-50956903 TGGGAGAGCAGAAAGGAGGGTGG - Intergenic
1024923316 7:54584958-54584980 AGGTAAAAGAGAAAGGAGGAAGG - Intergenic
1025474826 7:60906035-60906057 GAAGAGAAGAGAAAGGACGATGG + Intergenic
1025480963 7:60982075-60982097 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1025488071 7:61076955-61076977 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025512177 7:61583839-61583861 GAAGAGAAGAGAAAGGACGATGG - Intergenic
1025556734 7:62318871-62318893 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025565902 7:62433517-62433539 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1025837966 7:65113337-65113359 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1025879303 7:65519741-65519763 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025885103 7:65582634-65582656 GAAGAGAAGAGAAAGGAAGATGG - Intergenic
1025936410 7:66041276-66041298 GTGGAGAACAGAATGGAGGCTGG + Intergenic
1025947770 7:66117644-66117666 GTGGAGAACAGAATGGAGGCTGG - Intronic
1026106235 7:67422972-67422994 TTGTAGAACAGAAAAAAGGAAGG + Intergenic
1026184100 7:68068181-68068203 TTGGAGAGTAGAGAAGAGGAAGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026529706 7:71186254-71186276 TTGGAGAGGATAAAGGGGAAAGG - Intronic
1026594121 7:71720025-71720047 TTGGCAAAGAGAAGGGAAGATGG - Intergenic
1026596229 7:71736281-71736303 TGGTAGAAGAGAAGGGAGGTCGG - Intergenic
1026620359 7:71944857-71944879 TTGAAGAAGAGTTAGGAGGCAGG + Intronic
1026624865 7:71982917-71982939 TTGGCAAAGAGAAGGGAAGATGG - Intronic
1026654575 7:72246014-72246036 AGGGAGAAAAGAAAGGAGGCTGG - Intronic
1026661139 7:72303667-72303689 TTGGAAAAGAGAGTGAAGGAGGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026877984 7:73890625-73890647 GTGGAGAGGAGACGGGAGGAAGG - Intergenic
1026997272 7:74626003-74626025 AAAAAGAAGAGAAAGGAGGAAGG - Intergenic
1027306430 7:76902598-76902620 TTGCAGAGGAGAAATGAGAATGG + Intergenic
1027360422 7:77402727-77402749 GTGGAGAAGAGATGGGAGAAGGG + Intronic
1027730018 7:81859492-81859514 ATGGAGAAGAGAAAGCAGAGTGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027821654 7:83053468-83053490 TGGAAGAAAAGAATGGAGGAAGG + Intronic
1027978105 7:85184972-85184994 TCGGAGAAGGAAAAGGAGAAGGG + Intronic
1027978296 7:85186138-85186160 TGGGAGAAGGGAAAGGGGCAAGG - Intronic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028247964 7:88505181-88505203 TTAGACAAGAGAAAGGAATAAGG - Intergenic
1028349834 7:89832511-89832533 TTGGAGAAGAAAAGGGTGCAAGG - Intergenic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1028742631 7:94293406-94293428 TCTGGGAAGAGAAAGAAGGAAGG - Intergenic
1028797907 7:94925761-94925783 GGGGAGAAGAGGAAGGAGAAAGG - Intronic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029431443 7:100533513-100533535 GTGGAGTAGAGATGGGAGGAGGG + Intergenic
1029477697 7:100794843-100794865 GAAGAGAAGAGAAGGGAGGAGGG + Intronic
1029480266 7:100808019-100808041 TGGGAAAAGAGAAAGGAGGAAGG - Intronic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029621380 7:101691907-101691929 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1029910697 7:104144365-104144387 TTGGATAATAGAAAGGAAGGTGG - Intronic
1030178455 7:106679117-106679139 TTGGGGAAAAGAAAGAAAGAGGG + Intergenic
1030192359 7:106822293-106822315 TTGGGGAAGAGATATGTGGATGG + Intergenic
1030374370 7:108738162-108738184 CTGGAAAAGAGAAAGGAGCTTGG + Intergenic
1030801080 7:113852991-113853013 TTCCAGAAGAGAAAGAATGATGG + Intergenic
1030934604 7:115569824-115569846 TTTAGGAAGAGAAAGGAAGAAGG - Intergenic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031428930 7:121641842-121641864 ATGGAGAAGAGAATGGGAGAAGG - Intergenic
1031650444 7:124282551-124282573 TAGGTGAAGAGTAAGGAGGGAGG - Intergenic
1031682123 7:124687980-124688002 TTGGGGAAGAGATATGTGGATGG + Intergenic
1032090490 7:128909291-128909313 TAGGAACAGAGAGAGGAGGAGGG + Intronic
1032179694 7:129664118-129664140 GTGGAGACGGGAAAGGGGGAGGG + Intronic
1032217497 7:129968970-129968992 ATGGAAAAGAGAGAGGAGGCCGG + Intergenic
1032529068 7:132605150-132605172 TTGATGAAGAGAATGGAGCATGG + Intronic
1032650371 7:133871584-133871606 TTGGGGATGAGAAAGATGGAGGG - Intronic
1032842507 7:135725494-135725516 TTGGGCAAGAAAAAGGGGGAAGG + Intronic
1032986091 7:137338960-137338982 TTGGAGAGGAGAGAGGAAGGCGG + Intronic
1033180260 7:139170317-139170339 TTCCAAAAAAGAAAGGAGGAGGG + Intronic
1033268366 7:139907545-139907567 TTCCAGAAGATAAAAGAGGAGGG - Intronic
1033542618 7:142371434-142371456 TAAGAGAAGAGAAAGGATTATGG + Intergenic
1033804342 7:144937470-144937492 AAGGAGAAGGGAAAGGAGAAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034737881 7:153445957-153445979 GTGGAGAAGATAAAGCAGAAAGG + Intergenic
1034817297 7:154183591-154183613 ATGGAGGAAGGAAAGGAGGAGGG - Intronic
1035196865 7:157229158-157229180 TTGCAGAAAAGATAGGGGGAAGG - Intronic
1035280841 7:157776907-157776929 GAGGAGAAGAGCGAGGAGGAGGG - Intronic
1035500320 8:87238-87260 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
1035500373 8:87431-87453 ATGGAGAGGAGAAAGGAGAGGGG - Intergenic
1035672554 8:1431493-1431515 AAGAAGAAGAGAAAGGAGAAAGG + Intergenic
1035702906 8:1650929-1650951 CTGGAGCAGAGATGGGAGGACGG + Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1035848519 8:2890781-2890803 TTGAGGAAGAGCAAGGAGGCAGG + Intergenic
1035870337 8:3130618-3130640 TGAGAGAAGAGAAAGGAACAAGG - Intronic
1036087953 8:5634069-5634091 TGGGAGGAGGGAAAGGAGGCTGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036621324 8:10425932-10425954 TTGGAGAAGAGAAAAAGGCACGG - Intronic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036726435 8:11224879-11224901 TTGGAGAACATTATGGAGGAAGG - Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037349852 8:17941020-17941042 TCCGGGAAGAGAAAGGAGGCAGG - Intronic
1038288870 8:26230787-26230809 TTGGAGAAGGGAGAAAAGGAAGG + Intergenic
1038497412 8:28013361-28013383 ATGGGGAAGAGAGAGGGGGAGGG + Intergenic
1038512988 8:28158013-28158035 TGGAAGAAAGGAAAGGAGGAAGG - Intronic
1038537491 8:28364021-28364043 AAGCAGAAGAGAAAGAAGGAAGG + Intronic
1039023407 8:33231687-33231709 TTGGAGGTGAGAAGGGAGGTTGG - Intergenic
1039093803 8:33861107-33861129 AGGGAAAAGAGAAAGGAAGAAGG - Intergenic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039970157 8:42315386-42315408 TAGATGAAGAGAAAGGAGGAAGG + Intronic
1040559131 8:48508468-48508490 TTGGAGATGATAAAGGAGGGTGG + Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040605373 8:48926638-48926660 GTGGGGAAGAGAAAGCAGGGAGG - Intergenic
1040809652 8:51437815-51437837 TTGGACAAGAGAAAGAAATAAGG + Intronic
1040903097 8:52437648-52437670 TTCGAGAAGAGAAATGGGCAGGG - Intronic
1040980430 8:53241405-53241427 TTCTAGAAAAGAAAGGAGGGAGG + Intronic
1041369613 8:57144797-57144819 TGGGAGAAGGGAAAGTAAGAGGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041496073 8:58486630-58486652 TTGGAGAAGAGCAAGGAATGGGG - Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042286118 8:67112605-67112627 TCTGAGAATAGAAAGAAGGAGGG - Intronic
1042299619 8:67263089-67263111 TGGGAGCAGAGGAAGGAGAAGGG - Intronic
1042533110 8:69834350-69834372 GCTGAGAAAAGAAAGGAGGAAGG + Intronic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1042744598 8:72094206-72094228 GTAGAGCAGTGAAAGGAGGAGGG - Intronic
1043386861 8:79757478-79757500 CGGGAGAAGAGAAAAGAGGGAGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1045037494 8:98187112-98187134 TTGGAGGAGAGAAAGGTCTAGGG - Intergenic
1045055604 8:98365410-98365432 TTGATGAAGAGAAGGGAGGGAGG + Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045812378 8:106237935-106237957 TAAGAGAAGAAAAAGGAGTAGGG + Intergenic
1045953851 8:107883897-107883919 AGGGAGAAGAGAAAGGCAGAAGG + Intergenic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1046939562 8:119917762-119917784 TTGCAGTTGAGACAGGAGGAAGG + Intronic
1046957898 8:120080674-120080696 GTGAAGAAGAGAAAGAGGGAAGG + Intronic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047042319 8:121009582-121009604 TAGGAGGAGAGACAGCAGGATGG + Intergenic
1047142911 8:122162251-122162273 TTGGGGGAGAGAGAGGATGAAGG + Intergenic
1047238807 8:123066342-123066364 TTGGCAAAGAGAAGGGACGATGG + Intronic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1047685299 8:127299046-127299068 TTGGCAAAGAGAAGGGAAGATGG + Intergenic
1047692747 8:127373009-127373031 TTGAAGAAGAGAAAGTGGGCTGG + Intergenic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1047961390 8:130014592-130014614 TGGGAGCTGAGAAAGGAGAAGGG + Intronic
1048224495 8:132571583-132571605 GAGGAGAAGAGAGAGGAGAAAGG + Intergenic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1048711261 8:137213704-137213726 TTGGACAAGAGATAGCAGCAGGG - Intergenic
1048848790 8:138624459-138624481 TGGAAGGAAAGAAAGGAGGAGGG + Intronic
1048966357 8:139617807-139617829 TAGGAAAAGAGAAAGGAGTTAGG + Intronic
1049035721 8:140074421-140074443 TTGGAGATGAGGAAGAGGGACGG - Intronic
1049076531 8:140400755-140400777 CGGGAGCAGGGAAAGGAGGAAGG + Intronic
1049192326 8:141295199-141295221 TGGGTGAAGGGAAAGCAGGAGGG + Intronic
1049402117 8:142433036-142433058 TTGGGGAAGTCAGAGGAGGAGGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050303248 9:4280740-4280762 TCTGAGAAGAGTGAGGAGGAAGG - Intronic
1050315830 9:4399951-4399973 TTGGAGCAGAAATAGGAGGTGGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050723080 9:8613299-8613321 TTCTAGAAGAGAGAGCAGGAAGG + Intronic
1051011016 9:12414456-12414478 TTGAGGTAGAGAAGGGAGGATGG - Intergenic
1051238155 9:15023637-15023659 CTTGAGTAGGGAAAGGAGGATGG - Intergenic
1051257045 9:15224471-15224493 AAAGAGAAGAGAATGGAGGAAGG - Intronic
1051552956 9:18350485-18350507 ATTGAGAAGGGAAAGGAGCAAGG + Intergenic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052130698 9:24843276-24843298 ATGAAGAAGAGAATGAAGGAAGG - Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052195571 9:25709237-25709259 TTAGAAAGGAGAAAGAAGGAAGG + Intergenic
1052409441 9:28104211-28104233 TATGAGAAGAGTAAGGAGTAGGG + Intronic
1052582364 9:30374249-30374271 TTGCAGAAAATAAAAGAGGAGGG + Intergenic
1052703826 9:31970186-31970208 TGGGAGAAGAGGCTGGAGGATGG - Intergenic
1052994647 9:34545427-34545449 TGGAAGAAAGGAAAGGAGGAGGG - Intergenic
1053010564 9:34630560-34630582 TGGGAGAGGACAAGGGAGGAGGG - Intergenic
1053183023 9:35990617-35990639 TTGGAGAAGAGAGGGGAGTAAGG - Intergenic
1053450690 9:38191985-38192007 GGGGAGAAGGGAAAGGAGGCTGG - Intergenic
1053452120 9:38202206-38202228 TTGGAGAGGAGAATGGAGGCAGG + Intergenic
1053723134 9:40969806-40969828 TTGGAGAAGAGCATGCAGGCTGG - Intergenic
1054342832 9:63882186-63882208 TTGGAGAAGAGCATGCAGGCTGG + Intergenic
1054720597 9:68599905-68599927 ATGAAGAGGAGAGAGGAGGATGG - Intergenic
1054723856 9:68630629-68630651 GTGAAGGAGAAAAAGGAGGAGGG + Intergenic
1054731671 9:68706893-68706915 TTGGAGTGGAGAAAGGCGAAAGG + Intronic
1054740194 9:68798584-68798606 TTGGGGAATTGAAAGGAGGCTGG + Intronic
1055011278 9:71568816-71568838 TTGAAGAAGAGAATAAAGGAGGG + Intergenic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055751508 9:79511280-79511302 TTGAAGAAGAGAAAGAATGTTGG - Intergenic
1055775988 9:79767632-79767654 TGGGAGAGGGAAAAGGAGGATGG - Intergenic
1055829016 9:80358707-80358729 TGGGAGAGGAAAGAGGAGGAGGG + Intergenic
1055868232 9:80841611-80841633 TAGGAGTAGAGTGAGGAGGAGGG - Intergenic
1056246892 9:84704854-84704876 TTTGAGAACAGTAGGGAGGAAGG + Intronic
1056290748 9:85141458-85141480 TTGGGGGAGAGAAAGGAGGGAGG - Intergenic
1056368415 9:85929515-85929537 TTGGAGAGGAGGAAGAAGGTTGG - Intergenic
1056774007 9:89498265-89498287 TTGGGGGAGGGAAAGGAGGGAGG - Intergenic
1056849513 9:90070482-90070504 TTGAAGAAGAGCATGGAGGATGG + Intergenic
1057247006 9:93465044-93465066 TAGGAGAAGGGAAAACAGGAAGG + Intronic
1057483126 9:95461389-95461411 TTGGAGAGGTGACAGAAGGATGG - Intronic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1057493347 9:95540091-95540113 GTGGAGAAGAGAGAAGCGGAAGG - Intergenic
1057923153 9:99116266-99116288 TGGGAGAAGGGAAAGGAGGGAGG + Intronic
1058019924 9:100076343-100076365 TTGGGGAAGAGAAGGCAGGGTGG - Intronic
1058394816 9:104539252-104539274 TTTAAGAAGAGAGAGAAGGAGGG + Intergenic
1058400319 9:104609796-104609818 TTGGAAAGGTGAAAGGAGAAAGG - Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058601323 9:106673900-106673922 TGGGAAAAGACAAAGGAGGGGGG - Intergenic
1058885632 9:109320009-109320031 TCGGAGAAGAGGATGGGGGAGGG + Intronic
1059013292 9:110486593-110486615 ATGAAGCAGAGAAAGAAGGAAGG - Intronic
1059063989 9:111063458-111063480 TAGCTGAAGAGAAAGGAGTAAGG + Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059169859 9:112114815-112114837 TCAGAGGAAAGAAAGGAGGAAGG - Intronic
1059209756 9:112502089-112502111 CTGGTGAGTAGAAAGGAGGAGGG + Intronic
1059489982 9:114658968-114658990 CTGGAAAAGAGAAAGGAGGTTGG - Intergenic
1059652256 9:116325689-116325711 TTGGAGAAGAGAATGGTGTTGGG + Intronic
1059749145 9:117231588-117231610 TTGGGGAGGATAAAGGGGGAAGG + Intronic
1059819058 9:117951427-117951449 CTGGAGGAGACAAAGGGGGAGGG - Intergenic
1059819499 9:117956526-117956548 TTGGAGTAGAGAATGGCTGAGGG + Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059976441 9:119722884-119722906 TGAGAGAAGAGAAAGAGGGAGGG - Intergenic
1060198608 9:121638976-121638998 TTGGGGAAGGGATAGGAGTAGGG + Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060449578 9:123724071-123724093 TTTGAGAAGGGAAGGGAAGAAGG - Intronic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1060586787 9:124791434-124791456 TTAGAGAAGTGAAATGAGGCAGG + Intronic
1060763555 9:126276096-126276118 TGGGAGAAGAGAAGGCAGGTGGG - Intergenic
1060816733 9:126639075-126639097 TTGGAGAGGAGAGAAGAGGCTGG + Intronic
1060913498 9:127369693-127369715 TGGGAGAAGAGAAAGCAGACTGG + Intronic
1061039682 9:128132779-128132801 TTGGTCAAGGGAAAGGAGGGGGG - Intergenic
1061170208 9:128948014-128948036 TCGGAGGTGAGAGAGGAGGAAGG - Intronic
1061244685 9:129395387-129395409 ATGGAGGATAGACAGGAGGATGG + Intergenic
1061267027 9:129512159-129512181 TTGGAGGAGGCACAGGAGGAGGG + Intergenic
1061491705 9:130948435-130948457 TTGGAGCAGTGAAAGGTGGGAGG + Intergenic
1061643237 9:131976902-131976924 TGGGAGAGCAGAAAGGGGGAAGG - Intronic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061751607 9:132781936-132781958 ACAGAGATGAGAAAGGAGGAAGG + Intronic
1061890121 9:133614880-133614902 TGGGAGCAGAGAAAGGAGAATGG + Intergenic
1062251172 9:135594990-135595012 TTGGATAAGAGCAATGAGAAAGG - Intergenic
1203608534 Un_KI270748v1:75985-76007 ATGGAGAGGAGAAAGGAGAGGGG + Intergenic
1203608569 Un_KI270748v1:76106-76128 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1203615812 Un_KI270749v1:62495-62517 GAAGAGAAGAGAAAGGAAGATGG + Intergenic
1203635032 Un_KI270750v1:102351-102373 ATGGAGTAGAGAAAGAGGGAAGG + Intergenic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1186319179 X:8405597-8405619 TTGTAGATGAGAAAGGTGGGAGG - Intergenic
1186789582 X:12983874-12983896 TGGGTGAAGAGAAAGGGGTATGG + Intergenic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1186927943 X:14355915-14355937 TTGGGGAAAAGAAAGTATGAAGG - Intergenic
1187225199 X:17369295-17369317 TAGAAGGAGAGAAAGGCGGAGGG + Intergenic
1187316768 X:18203126-18203148 TGGGGGAAGGAAAAGGAGGATGG + Intronic
1187383750 X:18828988-18829010 GTGGAAAAGTGAAAGGAGCAGGG - Intergenic
1187524007 X:20037756-20037778 TTGGGGAAGAGATATGTGGATGG + Intronic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187843827 X:23515546-23515568 TTGGGGAAGGGAGGGGAGGAAGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1187999078 X:24961591-24961613 TGGGAGAAGAGGAAGTAGAAAGG - Intronic
1188436371 X:30163857-30163879 ATGGAGAAGAGAAGGTAGGGTGG + Intergenic
1188439702 X:30203532-30203554 TTGGAGGAAAGAAGGGAGGAAGG + Intergenic
1188569925 X:31572293-31572315 TTGGTTAAGAGAAATGGGGAAGG - Intronic
1188682389 X:33026846-33026868 TTGGAAATGAGAAAGGATGTAGG - Intronic
1189058542 X:37727180-37727202 TGGAAGAAGAGAAATGAGGCAGG + Intronic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189233975 X:39473736-39473758 TTGGAGATGGAAAAGGGGGAGGG + Intergenic
1189260630 X:39676177-39676199 TTGGATGAGAGAAAGGTAGAAGG - Intergenic
1189608557 X:42706185-42706207 TTGGATAAGAGAAAGTAGTAGGG - Intergenic
1190126198 X:47707796-47707818 GTTGAGAAGATAGAGGAGGAGGG + Intergenic
1190203199 X:48381502-48381524 TGGGAGAAGGGAAGGGAGAAGGG - Intergenic
1190207337 X:48413902-48413924 TGGGAGAAGGGAAGGGAGAAGGG + Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190420982 X:50284185-50284207 AGGGGGAAGAGAAAGGAAGATGG - Intronic
1190691751 X:52918528-52918550 TTGGACAAGAGTAGGGAGGTGGG - Intergenic
1190694232 X:52937264-52937286 TTGGACAAGAGTAGGGAGGTGGG + Intronic
1190712063 X:53078443-53078465 TTGGAGAAGTCAAGGGAGTAGGG + Exonic
1190886467 X:54534795-54534817 GGGGAGAAGAGAAGGGGGGAGGG - Intronic
1190981225 X:55458100-55458122 TTGGAGGAAAGAAATGAAGAAGG + Intergenic
1190987473 X:55515080-55515102 TTGGAGGAAAGAAATGAAGAAGG - Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191895332 X:65986785-65986807 AGGGAGAACAGAAAGGAAGAAGG - Intergenic
1192182973 X:68927792-68927814 TTGGTGAAGGGAAAGGAAGGGGG + Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192499066 X:71636825-71636847 TAGTAGAAGAGAAAGCAGGGGGG + Intergenic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1192673228 X:73168155-73168177 TTGGGGGAGAGAAGGCAGGATGG + Intergenic
1192899884 X:75485576-75485598 TTGGGAAAGGCAAAGGAGGATGG + Intronic
1193568375 X:83108762-83108784 TAGAACAAGACAAAGGAGGAGGG - Intergenic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1193742981 X:85241271-85241293 CTGGAGAGGAGAGAGAAGGAGGG + Intergenic
1193868578 X:86767758-86767780 TTGGAGAAGAGAAAGGTTATTGG + Intronic
1194087562 X:89547692-89547714 TAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1194352017 X:92832788-92832810 TTGAAGAAGACAAAGAATGATGG - Intergenic
1194361183 X:92952483-92952505 TTGGAGAAGAGGATGGAGCTAGG + Intergenic
1194774957 X:97951823-97951845 TTTAAGAAAATAAAGGAGGAAGG + Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195034391 X:100958582-100958604 TTTGAGAAAAGAGAGGAGGAGGG + Intergenic
1195252893 X:103065242-103065264 TTGGGGAAGAAATAGAAGGAAGG - Intergenic
1195263867 X:103161077-103161099 TTGGAGAAGAGAAGAGAGGGGGG + Intergenic
1195328253 X:103775523-103775545 TGGGAGAGGAGAGAAGAGGAGGG - Intronic
1195433788 X:104818829-104818851 TTAAAGAAGAGAAAACAGGAGGG + Intronic
1195458536 X:105097758-105097780 TTAGAGGAGAGGAAGGAGGGAGG - Intronic
1195569759 X:106385139-106385161 TTGGAGAAGACAAAAAGGGAGGG - Intergenic
1195696219 X:107669582-107669604 TGGGGGAGGAGGAAGGAGGAAGG - Intergenic
1195870556 X:109480988-109481010 GGGAAGAAGAGAAAGAAGGAAGG + Intronic
1196072475 X:111541818-111541840 TTGCAGAAGAGAAAGGAGTGGGG - Intergenic
1196377015 X:115044594-115044616 ATGGTGCAGAGAAAGGAAGATGG + Intergenic
1196710935 X:118761893-118761915 TGAGAGAACAGAAAGGAGGGTGG + Intronic
1197236410 X:124070271-124070293 TAGGAGAAGAGACTGAAGGAAGG + Intronic
1197655282 X:129110274-129110296 TTTGGGGAGAGAGAGGAGGATGG - Intergenic
1197744321 X:129920812-129920834 TTGGGGAAGAGCCATGAGGATGG + Intronic
1197775838 X:130118199-130118221 TTGGAGAGGAGAGATCAGGAGGG + Intergenic
1197795216 X:130291075-130291097 TTGGGGAAGAAAGAGGAAGATGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198069968 X:133138561-133138583 AGGGAGAAAAGAAAGGAGGGAGG + Intergenic
1198082407 X:133252204-133252226 GAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1198257187 X:134934036-134934058 TTGGAACAGTGAAAGGAGGTGGG - Intergenic
1198727915 X:139696325-139696347 GGAGAGAAGAGAAAGAAGGAAGG - Intronic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1199113997 X:143968547-143968569 TTGAAGAAGAGAGAAAAGGAAGG + Intergenic
1199282395 X:146017420-146017442 TTAGAGAAAATACAGGAGGACGG + Intergenic
1199472707 X:148212393-148212415 GTGGGGAAGAGAGAGGAGAAGGG - Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199862742 X:151816441-151816463 TTGGAGAAGGAATAGGTGGAAGG + Intergenic
1199895915 X:152127753-152127775 TTGGGGAAGAGAATGGAGGAGGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200440207 Y:3203562-3203584 TAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1200660325 Y:5949474-5949496 TTGAAGAAGACAAAGAATGATGG - Intergenic
1201550197 Y:15210834-15210856 TTGGAAGAGAGAGAGGGGGAGGG + Intergenic
1202233299 Y:22678630-22678652 CTGGAGAAGACACCGGAGGAAGG + Intergenic
1202309857 Y:23517528-23517550 CTGGAGAAGACACCGGAGGAAGG - Intergenic
1202560944 Y:26153065-26153087 CTGGAGAAGACACCGGAGGAAGG + Intergenic