ID: 919114239

View in Genome Browser
Species Human (GRCh38)
Location 1:193260606-193260628
Sequence AACTCCATCCTGTTACTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919114239_919114245 1 Left 919114239 1:193260606-193260628 CCCCTCAGTAACAGGATGGAGTT No data
Right 919114245 1:193260630-193260652 CTGTTTATACTGTGATGGGGAGG No data
919114239_919114244 -2 Left 919114239 1:193260606-193260628 CCCCTCAGTAACAGGATGGAGTT No data
Right 919114244 1:193260627-193260649 TTTCTGTTTATACTGTGATGGGG No data
919114239_919114243 -3 Left 919114239 1:193260606-193260628 CCCCTCAGTAACAGGATGGAGTT No data
Right 919114243 1:193260626-193260648 GTTTCTGTTTATACTGTGATGGG No data
919114239_919114246 12 Left 919114239 1:193260606-193260628 CCCCTCAGTAACAGGATGGAGTT No data
Right 919114246 1:193260641-193260663 GTGATGGGGAGGATTGTGTAAGG No data
919114239_919114247 29 Left 919114239 1:193260606-193260628 CCCCTCAGTAACAGGATGGAGTT No data
Right 919114247 1:193260658-193260680 GTAAGGATCAGATTTTGCAGTGG No data
919114239_919114242 -4 Left 919114239 1:193260606-193260628 CCCCTCAGTAACAGGATGGAGTT No data
Right 919114242 1:193260625-193260647 AGTTTCTGTTTATACTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919114239 Original CRISPR AACTCCATCCTGTTACTGAG GGG (reversed) Intergenic
No off target data available for this crispr