ID: 919124611

View in Genome Browser
Species Human (GRCh38)
Location 1:193379738-193379760
Sequence CTTAGCCTGTTACTGAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919124611_919124613 22 Left 919124611 1:193379738-193379760 CCAAAGTTCAGTAACAGGCTAAG No data
Right 919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG No data
919124611_919124612 18 Left 919124611 1:193379738-193379760 CCAAAGTTCAGTAACAGGCTAAG No data
Right 919124612 1:193379779-193379801 GAGTAGTTATCTACAGAAGATGG No data
919124611_919124614 23 Left 919124611 1:193379738-193379760 CCAAAGTTCAGTAACAGGCTAAG No data
Right 919124614 1:193379784-193379806 GTTATCTACAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919124611 Original CRISPR CTTAGCCTGTTACTGAACTT TGG (reversed) Intergenic
No off target data available for this crispr