ID: 919124613

View in Genome Browser
Species Human (GRCh38)
Location 1:193379783-193379805
Sequence AGTTATCTACAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919124611_919124613 22 Left 919124611 1:193379738-193379760 CCAAAGTTCAGTAACAGGCTAAG No data
Right 919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919124613 Original CRISPR AGTTATCTACAGAAGATGGC AGG Intergenic
No off target data available for this crispr