ID: 919130022

View in Genome Browser
Species Human (GRCh38)
Location 1:193439927-193439949
Sequence TAGGATCCTGTAAATTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919130015_919130022 29 Left 919130015 1:193439875-193439897 CCAGACTTACTGAGTGTCTGCTG No data
Right 919130022 1:193439927-193439949 TAGGATCCTGTAAATTGGGATGG No data
919130014_919130022 30 Left 919130014 1:193439874-193439896 CCCAGACTTACTGAGTGTCTGCT No data
Right 919130022 1:193439927-193439949 TAGGATCCTGTAAATTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919130022 Original CRISPR TAGGATCCTGTAAATTGGGA TGG Intergenic
No off target data available for this crispr