ID: 919130129

View in Genome Browser
Species Human (GRCh38)
Location 1:193440835-193440857
Sequence CAGTAGGAGTAATTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919130125_919130129 26 Left 919130125 1:193440786-193440808 CCATAAATTACAGTGAGAATTGC No data
Right 919130129 1:193440835-193440857 CAGTAGGAGTAATTGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919130129 Original CRISPR CAGTAGGAGTAATTGGATCC TGG Intergenic
No off target data available for this crispr