ID: 919135979

View in Genome Browser
Species Human (GRCh38)
Location 1:193508182-193508204
Sequence CAGTGCTAAAGTCATTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919135979_919135984 19 Left 919135979 1:193508182-193508204 CCCATTTAATGACTTTAGCACTG No data
Right 919135984 1:193508224-193508246 TTTTCAGGAAGGCAAGGAAAAGG No data
919135979_919135981 4 Left 919135979 1:193508182-193508204 CCCATTTAATGACTTTAGCACTG No data
Right 919135981 1:193508209-193508231 TTTTTTTCAGAATTTTTTTCAGG No data
919135979_919135982 8 Left 919135979 1:193508182-193508204 CCCATTTAATGACTTTAGCACTG No data
Right 919135982 1:193508213-193508235 TTTCAGAATTTTTTTCAGGAAGG No data
919135979_919135985 28 Left 919135979 1:193508182-193508204 CCCATTTAATGACTTTAGCACTG No data
Right 919135985 1:193508233-193508255 AGGCAAGGAAAAGGAAGAAATGG No data
919135979_919135983 13 Left 919135979 1:193508182-193508204 CCCATTTAATGACTTTAGCACTG No data
Right 919135983 1:193508218-193508240 GAATTTTTTTCAGGAAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919135979 Original CRISPR CAGTGCTAAAGTCATTAAAT GGG (reversed) Intergenic
No off target data available for this crispr