ID: 919141965

View in Genome Browser
Species Human (GRCh38)
Location 1:193583613-193583635
Sequence CTCCCACAATTCCGTGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919141965_919141971 6 Left 919141965 1:193583613-193583635 CCCACGACACGGAATTGTGGGAG No data
Right 919141971 1:193583642-193583664 TTCAAGCTGAGATTTGGGTGGGG 0: 65
1: 9430
2: 11421
3: 9065
4: 6660
919141965_919141970 5 Left 919141965 1:193583613-193583635 CCCACGACACGGAATTGTGGGAG No data
Right 919141970 1:193583641-193583663 ATTCAAGCTGAGATTTGGGTGGG 0: 66
1: 9490
2: 11122
3: 9750
4: 7284
919141965_919141969 4 Left 919141965 1:193583613-193583635 CCCACGACACGGAATTGTGGGAG No data
Right 919141969 1:193583640-193583662 AATTCAAGCTGAGATTTGGGTGG 0: 66
1: 9478
2: 11502
3: 9145
4: 8133
919141965_919141967 0 Left 919141965 1:193583613-193583635 CCCACGACACGGAATTGTGGGAG No data
Right 919141967 1:193583636-193583658 CTACAATTCAAGCTGAGATTTGG No data
919141965_919141968 1 Left 919141965 1:193583613-193583635 CCCACGACACGGAATTGTGGGAG No data
Right 919141968 1:193583637-193583659 TACAATTCAAGCTGAGATTTGGG 0: 61
1: 8819
2: 10684
3: 8651
4: 7398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919141965 Original CRISPR CTCCCACAATTCCGTGTCGT GGG (reversed) Intergenic
No off target data available for this crispr