ID: 919142759

View in Genome Browser
Species Human (GRCh38)
Location 1:193593320-193593342
Sequence ATGGAGAAGGAGAAAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919142759_919142763 -1 Left 919142759 1:193593320-193593342 CCCTTTTCTTTCTCCTTCTCCAT No data
Right 919142763 1:193593342-193593364 TCTGTCTTTAACACATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919142759 Original CRISPR ATGGAGAAGGAGAAAGAAAA GGG (reversed) Intergenic
No off target data available for this crispr