ID: 919147336

View in Genome Browser
Species Human (GRCh38)
Location 1:193651935-193651957
Sequence AGGGAGAGCACAGTAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919147336_919147341 14 Left 919147336 1:193651935-193651957 CCCACAGTTACTGTGCTCTCCCT No data
Right 919147341 1:193651972-193651994 GATTCTTTCTCTGCACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919147336 Original CRISPR AGGGAGAGCACAGTAACTGT GGG (reversed) Intergenic
No off target data available for this crispr