ID: 919169384

View in Genome Browser
Species Human (GRCh38)
Location 1:193934950-193934972
Sequence GCCTGGGGTGCGCTAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919169376_919169384 2 Left 919169376 1:193934925-193934947 CCTGGCAGCCTAGGCAGCCTAGG No data
Right 919169384 1:193934950-193934972 GCCTGGGGTGCGCTAGAGGCAGG No data
919169374_919169384 16 Left 919169374 1:193934911-193934933 CCACTCTGGGTGGGCCTGGCAGC No data
Right 919169384 1:193934950-193934972 GCCTGGGGTGCGCTAGAGGCAGG No data
919169378_919169384 -6 Left 919169378 1:193934933-193934955 CCTAGGCAGCCTAGGCAGCCTGG No data
Right 919169384 1:193934950-193934972 GCCTGGGGTGCGCTAGAGGCAGG No data
919169372_919169384 20 Left 919169372 1:193934907-193934929 CCTGCCACTCTGGGTGGGCCTGG No data
Right 919169384 1:193934950-193934972 GCCTGGGGTGCGCTAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919169384 Original CRISPR GCCTGGGGTGCGCTAGAGGC AGG Intergenic
No off target data available for this crispr