ID: 919176321

View in Genome Browser
Species Human (GRCh38)
Location 1:194023332-194023354
Sequence GTATCCCTAGTGCCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919176320_919176321 21 Left 919176320 1:194023288-194023310 CCTGATTTTATTTTATTTTATTT 0: 16
1: 228
2: 496
3: 2116
4: 13845
Right 919176321 1:194023332-194023354 GTATCCCTAGTGCCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919176321 Original CRISPR GTATCCCTAGTGCCTAGAGC AGG Intergenic
No off target data available for this crispr