ID: 919183207

View in Genome Browser
Species Human (GRCh38)
Location 1:194112015-194112037
Sequence GGTTCAAAGGAGCAAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919183207_919183216 28 Left 919183207 1:194112015-194112037 CCGCCCGCTTGCTCCTTTGAACC No data
Right 919183216 1:194112066-194112088 ATTTAGTAAAACACAGTGTGTGG No data
919183207_919183215 1 Left 919183207 1:194112015-194112037 CCGCCCGCTTGCTCCTTTGAACC No data
Right 919183215 1:194112039-194112061 TGGGAGAAGATGATTGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919183207 Original CRISPR GGTTCAAAGGAGCAAGCGGG CGG (reversed) Intergenic
No off target data available for this crispr