ID: 919188472

View in Genome Browser
Species Human (GRCh38)
Location 1:194184929-194184951
Sequence ACTTTGTAGGTCCTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919188468_919188472 24 Left 919188468 1:194184882-194184904 CCCTGGGGGAAGGATGCAGGGAA No data
Right 919188472 1:194184929-194184951 ACTTTGTAGGTCCTTTTCTCTGG No data
919188469_919188472 23 Left 919188469 1:194184883-194184905 CCTGGGGGAAGGATGCAGGGAAT No data
Right 919188472 1:194184929-194184951 ACTTTGTAGGTCCTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919188472 Original CRISPR ACTTTGTAGGTCCTTTTCTC TGG Intergenic
No off target data available for this crispr