ID: 919201172

View in Genome Browser
Species Human (GRCh38)
Location 1:194357199-194357221
Sequence AGAGTTTCTAACTGACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919201169_919201172 19 Left 919201169 1:194357157-194357179 CCACTTCTCAGAGACTGGGAGTG No data
Right 919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919201172 Original CRISPR AGAGTTTCTAACTGACAGCC AGG Intergenic
No off target data available for this crispr