ID: 919204581

View in Genome Browser
Species Human (GRCh38)
Location 1:194405711-194405733
Sequence TATGGCTGCATAGTATTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53458
Summary {0: 557, 1: 25344, 2: 14200, 3: 8088, 4: 5269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919204581_919204586 16 Left 919204581 1:194405711-194405733 CCATAGAATACTATGCAGCCATA 0: 557
1: 25344
2: 14200
3: 8088
4: 5269
Right 919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG No data
919204581_919204585 12 Left 919204581 1:194405711-194405733 CCATAGAATACTATGCAGCCATA 0: 557
1: 25344
2: 14200
3: 8088
4: 5269
Right 919204585 1:194405746-194405768 GTCATGTTCTTTGCAGGACATGG No data
919204581_919204587 25 Left 919204581 1:194405711-194405733 CCATAGAATACTATGCAGCCATA 0: 557
1: 25344
2: 14200
3: 8088
4: 5269
Right 919204587 1:194405759-194405781 CAGGACATGGATGGAGTTAGAGG No data
919204581_919204584 6 Left 919204581 1:194405711-194405733 CCATAGAATACTATGCAGCCATA 0: 557
1: 25344
2: 14200
3: 8088
4: 5269
Right 919204584 1:194405740-194405762 AATGAGGTCATGTTCTTTGCAGG No data
919204581_919204582 -10 Left 919204581 1:194405711-194405733 CCATAGAATACTATGCAGCCATA 0: 557
1: 25344
2: 14200
3: 8088
4: 5269
Right 919204582 1:194405724-194405746 TGCAGCCATAAAAAAGAATGAGG 0: 41
1: 178
2: 265
3: 415
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919204581 Original CRISPR TATGGCTGCATAGTATTCTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr