ID: 919204583

View in Genome Browser
Species Human (GRCh38)
Location 1:194405729-194405751
Sequence CATGACCTCATTCTTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48100
Summary {0: 38, 1: 2273, 2: 11493, 3: 21571, 4: 12725}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919204583_919204585 -6 Left 919204583 1:194405729-194405751 CCATAAAAAAGAATGAGGTCATG 0: 38
1: 2273
2: 11493
3: 21571
4: 12725
Right 919204585 1:194405746-194405768 GTCATGTTCTTTGCAGGACATGG No data
919204583_919204587 7 Left 919204583 1:194405729-194405751 CCATAAAAAAGAATGAGGTCATG 0: 38
1: 2273
2: 11493
3: 21571
4: 12725
Right 919204587 1:194405759-194405781 CAGGACATGGATGGAGTTAGAGG No data
919204583_919204586 -2 Left 919204583 1:194405729-194405751 CCATAAAAAAGAATGAGGTCATG 0: 38
1: 2273
2: 11493
3: 21571
4: 12725
Right 919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919204583 Original CRISPR CATGACCTCATTCTTTTTTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr