ID: 919204586

View in Genome Browser
Species Human (GRCh38)
Location 1:194405750-194405772
Sequence TGTTCTTTGCAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919204583_919204586 -2 Left 919204583 1:194405729-194405751 CCATAAAAAAGAATGAGGTCATG 0: 38
1: 2273
2: 11493
3: 21571
4: 12725
Right 919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG No data
919204581_919204586 16 Left 919204581 1:194405711-194405733 CCATAGAATACTATGCAGCCATA 0: 557
1: 25344
2: 14200
3: 8088
4: 5269
Right 919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919204586 Original CRISPR TGTTCTTTGCAGGACATGGA TGG Intergenic
No off target data available for this crispr