ID: 919204745

View in Genome Browser
Species Human (GRCh38)
Location 1:194407486-194407508
Sequence CACTTTTAAAAGAGGGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919204741_919204745 -7 Left 919204741 1:194407470-194407492 CCAAGCTCGGAGTAGCCACTTTT No data
Right 919204745 1:194407486-194407508 CACTTTTAAAAGAGGGCTGTTGG No data
919204739_919204745 19 Left 919204739 1:194407444-194407466 CCACATTGGAATGTTGATTAATC No data
Right 919204745 1:194407486-194407508 CACTTTTAAAAGAGGGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919204745 Original CRISPR CACTTTTAAAAGAGGGCTGT TGG Intergenic
No off target data available for this crispr