ID: 919205800

View in Genome Browser
Species Human (GRCh38)
Location 1:194420638-194420660
Sequence AAGGGTGCACACACCTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919205795_919205800 14 Left 919205795 1:194420601-194420623 CCAAAGTTGCAAGGGGCTGATGT No data
Right 919205800 1:194420638-194420660 AAGGGTGCACACACCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919205800 Original CRISPR AAGGGTGCACACACCTACCC AGG Intergenic
No off target data available for this crispr