ID: 919207620

View in Genome Browser
Species Human (GRCh38)
Location 1:194437506-194437528
Sequence TCTTGCATGCTGGTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919207620_919207629 29 Left 919207620 1:194437506-194437528 CCTTGCTCCACCAGCATGCAAGA No data
Right 919207629 1:194437558-194437580 AACTATTGCAGATGGAGCCTTGG No data
919207620_919207627 21 Left 919207620 1:194437506-194437528 CCTTGCTCCACCAGCATGCAAGA No data
Right 919207627 1:194437550-194437572 CCTCCAACAACTATTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919207620 Original CRISPR TCTTGCATGCTGGTGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr