ID: 919220189

View in Genome Browser
Species Human (GRCh38)
Location 1:194618059-194618081
Sequence AGCGGGTTGCTGCTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919220189_919220194 -1 Left 919220189 1:194618059-194618081 CCAGTCAGCAGCAGCAACCCGCT No data
Right 919220194 1:194618081-194618103 TTAGGTGCCCTTTCACGGTATGG No data
919220189_919220192 -6 Left 919220189 1:194618059-194618081 CCAGTCAGCAGCAGCAACCCGCT No data
Right 919220192 1:194618076-194618098 CCCGCTTAGGTGCCCTTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919220189 Original CRISPR AGCGGGTTGCTGCTGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr