ID: 919220814

View in Genome Browser
Species Human (GRCh38)
Location 1:194625972-194625994
Sequence CAGAGAGAATGGAATAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919220810_919220814 12 Left 919220810 1:194625937-194625959 CCGAACCTACGACTGACTGGGGT No data
Right 919220814 1:194625972-194625994 CAGAGAGAATGGAATAAAGTTGG No data
919220811_919220814 7 Left 919220811 1:194625942-194625964 CCTACGACTGACTGGGGTACCTG No data
Right 919220814 1:194625972-194625994 CAGAGAGAATGGAATAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919220814 Original CRISPR CAGAGAGAATGGAATAAAGT TGG Intergenic
No off target data available for this crispr