ID: 919220864

View in Genome Browser
Species Human (GRCh38)
Location 1:194626608-194626630
Sequence CATTCTGTGTCTTTTACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5519
Summary {0: 3, 1: 217, 2: 1963, 3: 1759, 4: 1577}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919220864_919220870 8 Left 919220864 1:194626608-194626630 CCCCAAGTAAAAGACACAGAATG 0: 3
1: 217
2: 1963
3: 1759
4: 1577
Right 919220870 1:194626639-194626661 GGTAAAGAGTCAAGACCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919220864 Original CRISPR CATTCTGTGTCTTTTACTTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr