ID: 919220865

View in Genome Browser
Species Human (GRCh38)
Location 1:194626609-194626631
Sequence CCATTCTGTGTCTTTTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5793
Summary {0: 3, 1: 224, 2: 2039, 3: 1892, 4: 1635}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919220865_919220870 7 Left 919220865 1:194626609-194626631 CCCAAGTAAAAGACACAGAATGG 0: 3
1: 224
2: 2039
3: 1892
4: 1635
Right 919220870 1:194626639-194626661 GGTAAAGAGTCAAGACCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919220865 Original CRISPR CCATTCTGTGTCTTTTACTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr