ID: 919220870

View in Genome Browser
Species Human (GRCh38)
Location 1:194626639-194626661
Sequence GGTAAAGAGTCAAGACCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919220865_919220870 7 Left 919220865 1:194626609-194626631 CCCAAGTAAAAGACACAGAATGG 0: 3
1: 224
2: 2039
3: 1892
4: 1635
Right 919220870 1:194626639-194626661 GGTAAAGAGTCAAGACCTATTGG No data
919220864_919220870 8 Left 919220864 1:194626608-194626630 CCCCAAGTAAAAGACACAGAATG 0: 3
1: 217
2: 1963
3: 1759
4: 1577
Right 919220870 1:194626639-194626661 GGTAAAGAGTCAAGACCTATTGG No data
919220867_919220870 6 Left 919220867 1:194626610-194626632 CCAAGTAAAAGACACAGAATGGC 0: 7
1: 251
2: 6726
3: 3947
4: 3032
Right 919220870 1:194626639-194626661 GGTAAAGAGTCAAGACCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919220870 Original CRISPR GGTAAAGAGTCAAGACCTAT TGG Intergenic
No off target data available for this crispr