ID: 919224598

View in Genome Browser
Species Human (GRCh38)
Location 1:194679722-194679744
Sequence CATTGTAAACAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919224593_919224598 -9 Left 919224593 1:194679708-194679730 CCAAGGAAGAATAACATTGTAAA No data
Right 919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG No data
919224591_919224598 17 Left 919224591 1:194679682-194679704 CCATTTCATTAATGATAAAGAGT No data
Right 919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919224598 Original CRISPR CATTGTAAACAGAAGGGGCA GGG Intergenic
No off target data available for this crispr