ID: 919224939

View in Genome Browser
Species Human (GRCh38)
Location 1:194685369-194685391
Sequence GTGAACAATAGTAGGAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919224939_919224941 15 Left 919224939 1:194685369-194685391 CCAATTCTCCTACTATTGTTCAC No data
Right 919224941 1:194685407-194685429 TCCCAGTCCTCATTCCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919224939 Original CRISPR GTGAACAATAGTAGGAGAAT TGG (reversed) Intergenic
No off target data available for this crispr