ID: 919236734

View in Genome Browser
Species Human (GRCh38)
Location 1:194855275-194855297
Sequence TTGTATTTTTAGTAAAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 533015
Summary {0: 1957, 1: 69203, 2: 164157, 3: 184952, 4: 112746}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236734_919236742 25 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG No data
919236734_919236736 -10 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236736 1:194855288-194855310 AAAAATACAAAAAATTAGCTGGG 0: 19594
1: 68711
2: 45259
3: 39801
4: 74226
919236734_919236738 -2 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236738 1:194855296-194855318 AAAAAATTAGCTGGGCGTGGTGG 0: 12832
1: 74490
2: 167805
3: 193889
4: 182442
919236734_919236740 2 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236740 1:194855300-194855322 AATTAGCTGGGCGTGGTGGCGGG 0: 10174
1: 43081
2: 75581
3: 71688
4: 48204
919236734_919236739 1 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236739 1:194855299-194855321 AAATTAGCTGGGCGTGGTGGCGG 0: 10244
1: 39956
2: 61717
3: 51309
4: 28030
919236734_919236737 -5 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236737 1:194855293-194855315 TACAAAAAATTAGCTGGGCGTGG 0: 7863
1: 33095
2: 44555
3: 58584
4: 93502
919236734_919236741 21 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236741 1:194855319-194855341 CGGGCACCTACATTCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919236734 Original CRISPR TTGTATTTTTAGTAAAGACA AGG (reversed) Intergenic
Too many off-targets to display for this crispr