ID: 919236736

View in Genome Browser
Species Human (GRCh38)
Location 1:194855288-194855310
Sequence AAAAATACAAAAAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247591
Summary {0: 19594, 1: 68711, 2: 45259, 3: 39801, 4: 74226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236732_919236736 13 Left 919236732 1:194855252-194855274 CCATCCTGGCTAACATGGTGAAA 0: 20052
1: 73412
2: 150082
3: 168644
4: 142970
Right 919236736 1:194855288-194855310 AAAAATACAAAAAATTAGCTGGG 0: 19594
1: 68711
2: 45259
3: 39801
4: 74226
919236733_919236736 9 Left 919236733 1:194855256-194855278 CCTGGCTAACATGGTGAAACCTT 0: 229
1: 8711
2: 72498
3: 185303
4: 195141
Right 919236736 1:194855288-194855310 AAAAATACAAAAAATTAGCTGGG 0: 19594
1: 68711
2: 45259
3: 39801
4: 74226
919236734_919236736 -10 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236736 1:194855288-194855310 AAAAATACAAAAAATTAGCTGGG 0: 19594
1: 68711
2: 45259
3: 39801
4: 74226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919236736 Original CRISPR AAAAATACAAAAAATTAGCT GGG Intergenic
Too many off-targets to display for this crispr